Ketone reductase mutant and preparation method thereof

A reductase and mutant technology, which is applied in the field of ketoreductase mutants and their preparation, can solve the problems of many side reactions, high cost, and low yield, and achieve mild reaction conditions, low waste discharge, and low equipment requirements. Effect

Active Publication Date: 2015-02-11
NANJING LANGEN BIOLOGICAL SCI & TECH
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to harsh conditions in the chemical synthesis process, many side reactions, difficult separation and purification of products, low yield and high cost, it is difficult to become an ideal method for commercial scale synthesis
Enzymatic preparation of stereoisomerically pure cis-3,5-dihydroxyhexanoate req

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1）

[0021] Construction of wild-type and ketoreductase mutant expression vectors

[0022] The polynucleotide (SEQ ID NO: 1) encoding wild-type ketoreductase from Saccharomces cerevisiae was obtained by whole gene synthesis after sequence optimization. The optimized polynucleotide encoding ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid that can express wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is the method of homologous recombination, and the amplification primers used are:

[0023] F: 5' ATTAAAGAGGAGAAATTAACATATGTCTTTCCACCAGCAGTTCTTCA 3';

[0024] R: 5' AACAGGAGTCCAAGCTCAGCTTATTAAACTTTCTGAGCAGCGTAGTTG 3'.

[0025] Similarly, the polynucleotide encoding the ketoreductase mutant (SEQ ID NO: 3) was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing the keto...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a ketone reductase mutant and a preparation method thereof. The ketone reductase mutant comes from a saccharomyces cerevisiae wild type ketone reductase, is capable of converting 5-hydroxyl-3-oxohexanoate into corresponding cis 3,5-dihydroxylhexanoate, and has one or more mutants of I46V, S127N and Q144K. The ketone reductase mutant has obvious high specific enzyme activity which is improved by 2-100 times compared with that of the wild type ketone reductase, can be utilized to biologically catalyze 5-hydroxyl-3-oxohexanoate to product corresponding cis 3,5-dihydroxylhexanoate. The reaction conditions are mild, requirements on equipment are low, the production process does not need high temperature or cooling, and energy consumption is low. Because enzyme catalysis has efficient specific selectivity, the process of producing the statin medicine key intermediate cis 3,5-dihydroxylhexanoate, does not generate by-products, and purification is convenient. Additionally, the solvent employed in the reaction is mainly water, "three wastes (waste gas, waste water and industrial residue)" discharge is low, and the reaction is green and environment-friendly.

Description

technical field [0001] The present invention relates to a ketoreductase mutant and a preparation method thereof, in particular to a ketoreductase mutant derived from Saccharomyces cerevisiae and an efficient preparation method thereof. Background technique [0002] Atorvastatin calcium (sold by Pfizer under the trade name LIPITOR), rosuvastatin calcium (sold by AstraZeneca under the trade name CRESTOR), and pitavastatin (sold under the trade name Lipalo by Nissan Chemical and Kowa in Japan), are important cholesterol-lowering statins. Stereoisomerically pure cis 3,5-dihydroxycaproate is a key chiral intermediate for these important statins. Many of the known routes for preparing these chiral intermediates, both chemical and enzymatic, suffer from a number of disadvantages. Due to the harsh conditions of the chemical synthesis process, many side reactions, difficult product separation and purification, low yield and high cost, it is difficult to become an ideal method for c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62C12R1/19
CPCC12N9/0006C12P7/62C12Y101/01184
Inventor 丁雪峰
Owner NANJING LANGEN BIOLOGICAL SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap