A kind of ketoreductase mutant and its preparation method
A reductase and mutant technology, applied in the field of ketoreductase mutants and their preparation, can solve the problems of many side reactions, high cost, low yield, etc., and achieve mild reaction conditions, low three-waste emissions, and low equipment requirements. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1)
[0022] Construction of wild-type and ketoreductase mutant expression vectors
[0023] The polynucleotide (SEQ ID NO: 1) encoding the wild-type ketoreductase from Saccharomces cerevisiae is sequence-optimized and obtained by whole gene synthesis. The optimized polynucleotide encoding ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is homologous recombination, and the amplification primers used are:
[0024] F: 5' ATTAAAGAGGAGAAATTAACATATGTCTTTTCCACCAGCAGTTCTTCA 3';
[0025] R: 5' AACAGGAGTCCAAGCTCAGCTTATTAAACTTTCTGAGCAGCGTAGTTG 3'.
[0026]Similarly, the polynucleotide (SEQ ID NO: 3) encoding the mutant ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing the mutant ketoredu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com