A kind of ketoreductase mutant and its preparation method

A reductase and mutant technology, applied in the field of ketoreductase mutants and their preparation, can solve the problems of many side reactions, high cost, low yield, etc., and achieve mild reaction conditions, low three-waste emissions, and low equipment requirements. Effect

Active Publication Date: 2017-04-19
NANJING LANGEN BIOLOGICAL SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to harsh conditions in the chemical synthesis process, many side reactions, difficult separation and purification of products, low yield and high cost, it is difficult to become an ideal method for commercial scale synthesis
Enzymatic preparation of stereoisomerically pure cis-3,5-dihydroxyhexanoate requires the use of stereoselective ketoreductase, but the catalytic activity of the existing wild-type ketoreductase is very low, and the use of 10g / L Crude enzyme powder can only convert 1g / L of ketone substrate in 20 hours, which also makes it difficult to be an ideal method for commercial scale synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1)

[0022] Construction of wild-type and ketoreductase mutant expression vectors

[0023] The polynucleotide (SEQ ID NO: 1) encoding the wild-type ketoreductase from Saccharomces cerevisiae is sequence-optimized and obtained by whole gene synthesis. The optimized polynucleotide encoding ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is homologous recombination, and the amplification primers used are:

[0024] F: 5' ATTAAAGAGGAGAAATTAACATATGTCTTTTCCACCAGCAGTTCTTCA 3';

[0025] R: 5' AACAGGAGTCCAAGCTCAGCTTATTAAACTTTCTGAGCAGCGTAGTTG 3'.

[0026]Similarly, the polynucleotide (SEQ ID NO: 3) encoding the mutant ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing the mutant ketoredu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a ketone reductase mutant and a preparation method thereof. The ketone reductase mutant comes from a saccharomyces cerevisiae wild type ketone reductase, is capable of converting 5-hydroxyl-3-oxohexanoate into corresponding cis 3,5-dihydroxylhexanoate, and has one or more mutants of I46V, S127N and Q144K. The ketone reductase mutant has obvious high specific enzyme activity which is improved by 2-100 times compared with that of the wild type ketone reductase, can be utilized to biologically catalyze 5-hydroxyl-3-oxohexanoate to product corresponding cis 3,5-dihydroxylhexanoate. The reaction conditions are mild, requirements on equipment are low, the production process does not need high temperature or cooling, and energy consumption is low. Because enzyme catalysis has efficient specific selectivity, the process of producing the statin medicine key intermediate cis 3,5-dihydroxylhexanoate, does not generate by-products, and purification is convenient. Additionally, the solvent employed in the reaction is mainly water, "three wastes (waste gas, waste water and industrial residue)" discharge is low, and the reaction is green and environment-friendly.

Description

technical field [0001] The invention relates to a ketoreductase mutant and a preparation method thereof, in particular to a ketoreductase mutant derived from Saccharomyces cerevisiae and an efficient preparation method thereof. Background technique [0002] Atorvastatin calcium (trade name LIPITOR sold by Pfizer), rosuvastatin calcium (trade name CRESTOR sold by AstraZeneca) and pitavastatin (trade name Lipalo sold by Nissan Chemical and Kowa in Japan), Is an important cholesterol-lowering statin drugs. Stereomerically pure cis-3,5-dihydroxyhexanoate is the key chiral intermediate of these important statins. The many routes known to prepare these chiral intermediates, both chemical and enzymatic, suffer from a number of disadvantages. Due to harsh conditions in the chemical synthesis process, many side reactions, difficulty in product separation and purification, low yield, and high cost, it is difficult to become an ideal method for commercial-scale synthesis. Enzymatic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62C12R1/19
CPCC12N9/0006C12P7/62C12Y101/01184
Inventor丁雪峰
OwnerNANJING LANGEN BIOLOGICAL SCI & TECH