Activity enhanced ketoreductase mutant, coding sequence and preparation method thereof
An activity-enhancing, reductase technology, applied in the field of ketoreductase, can solve the problems of harsh chemical synthesis process conditions, difficult product separation and purification, low catalytic activity, etc., and achieves low equipment requirements, high specific enzyme activity, and convenient purification. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1)
[0021] Construction of wild-type and ketoreductase mutant expression vectors
[0022] The polynucleotide (SEQ ID NO: 1) encoding wild-type ketoreductase from Candida magnoliae is sequence optimized and obtained by whole gene synthesis. The optimized polynucleotide encoding ketoreductase is cloned under the control of the promoter of the improved expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is homologous recombination, and the amplification primers used are:
[0023] F: 5' ATTAAAGAGGAGAAATTAACATATGGCTAAAAACTTCTCTAACGTTC 3';
[0024] R: 5'AACAGGAGTCCAAGTCCAGCTTATTACGGCAGGGTGTAACCAC3'.
[0025] Similarly, the polynucleotide (SEQ ID NO: 3) encoding the ketoreductase mutant was cloned into the expression vector (SEQ ID NO. 5) under the control of the promoter to obtain a plasmid capable of expressing the ketoreductase mutant. T...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com