Activity enhanced ketoreductase mutant, coding sequence and preparation method thereof

An activity-enhancing, reductase technology, applied in the field of ketoreductase, can solve the problems of harsh chemical synthesis process conditions, difficult product separation and purification, low catalytic activity, etc., and achieves low equipment requirements, high specific enzyme activity, and convenient purification. Effect

Active Publication Date: 2015-02-11
NANJING NUOYUN BIOLOGICAL TECH CO LTD
View PDF2 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to harsh conditions in the chemical synthesis process, many side reactions, difficult separation and purification of products, low yield and high cost, it is difficult to become an ideal method for commercial scale synthesis
Enzymatic preparation and chiral (S)-4-chloro-3-hydroxy-butyric acid ethyl ester require the use of a stereoselective ketoreductase, but the existing wild-type ketoreductase has a very low catalytic activity. 10g / L crude enzyme powder can only convert 1g / L of ketone substrate in 20 hours, which also makes it difficult to be an ideal method for commercial scale synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1)

[0021] Construction of wild-type and ketoreductase mutant expression vectors

[0022] The polynucleotide (SEQ ID NO: 1) encoding wild-type ketoreductase from Candida magnoliae is sequence optimized and obtained by whole gene synthesis. The optimized polynucleotide encoding ketoreductase is cloned under the control of the promoter of the improved expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is homologous recombination, and the amplification primers used are:

[0023] F: 5' ATTAAAGAGGAGAAATTAACATATGGCTAAAAACTTCTCTAACGTTC 3';

[0024] R: 5'AACAGGAGTCCAAGTCCAGCTTATTACGGCAGGGTGTAACCAC3'.

[0025] Similarly, the polynucleotide (SEQ ID NO: 3) encoding the ketoreductase mutant was cloned into the expression vector (SEQ ID NO. 5) under the control of the promoter to obtain a plasmid capable of expressing the ketoreductase mutant. T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an activity enhanced ketoreductase mutant, which is derived from wild-type ketoreductase of Candida magnoliae, can transform 4-chloroacetoacetic acid ethyl ester into (S)-4-chloro-3-hydroxy butyric acid ethyl ester, and has one or more mutations of E9R, S42Q, T190L and E234M. The ketoreductase mutant provided by the invention has obvious high specific enzyme activity, which is increased by 2-20 times than wild-type ketoreductase. According to the invention, the reaction conditions are mild, the requirement for equipment is low, the production process has need for high temperature or cooling, the energy consumption is low, and as enzyme catalysis has high efficiency and specific selectivity, production of the statin drug key intermediate (S)-4-chloro-3-hydroxy butyric acid ethyl ester by the method generates no by-product, and purification can be convenient. In addition, most solvents involved in the reaction of the invention are water, thus having low discharge of three wastes, and being green and environment-friendly.

Description

technical field [0001] The present invention relates to a ketoreductase, and the present invention relates to a ketoreductase mutant and a preparation method thereof, in particular to a ketoreductase mutant derived from Candida magnolia, a coding sequence and a preparation method thereof Background technique [0002] Atorvastatin calcium (trade name LIPITOR sold by Pfizer), rosuvastatin calcium (trade name CRESTOR sold by AstraZeneca) and pitavastatin (trade name Lipalo sold by Nissan Chemical and Kowa in Japan), Is an important cholesterol-lowering statin drugs. Chiral (S)-4-chloro-3-hydroxy-butyric acid ethyl ester is the key chiral intermediate of these important statins. The domestic production of this intermediate in 2009 was 400 tons, and it is expected that in the next few years, the domestic production will reach more than 1,000 tons, and the direct economic benefits will be several hundred million yuan. The many routes known to prepare these chiral intermediates, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62C12R1/72
CPCC12N9/0006C12P7/62C12Y101/01184
Inventor丁雪峰
OwnerNANJING NUOYUN BIOLOGICAL TECH CO LTD