Long-acting coagulation factors and methods of producing same

A technology for coagulation factors and factors, which can be used in coagulation/fibrinolytic factors, chemical instruments and methods, growth factors/inducing factors, etc., and can solve problems such as prolonging half-life

Inactive Publication Date: 2015-03-18
OPKO BIOLOGICS
View PDF30 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the challenge is to achieve an extended half-life of the protein while retaining its biological activity and ensuring that the modification does not induce significant immunogenicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long-acting coagulation factors and methods of producing same
  • Long-acting coagulation factors and methods of producing same
  • Long-acting coagulation factors and methods of producing same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0810] Preparation and Utilization of Coagulation Factor IX

[0811] Cloning and expression of recombinant FIX molecules:

[0812] Factor IX clones were constructed in our eukaryotic expression vector pCI-neo (Promega, catalog #E1841). An ORF clone of Homo sapiens coagulation factor IX was ordered from "OriGene" (RC219065). Order primers from Sigma-Genosys.

[0813] Construction of 301-1-pCI-neo-p200-11 (Factor IX-ctp x2):

[0814] Primer 101: 5'GTTTAGTGAACCGTCAGAAT 3' (SEQ ID NO:36)

[0815] Primer 103 R : 5'TTGAGGAAGATGTTCGTGTA 3' (SspI site containing Factor IX) (SEQ ID NO:37)

[0816] Primer 101 and Primer 103 R and plasmid DNA, a cDNA clone of Factor IX (OriGene" RC219065) (as a template), a PCR reaction was performed; as a result of PCR amplification, an approximately 1085 bp product (pcr 10) was formed and purified from a gel (containing the Factor IX sequence amino-terminal fragment).

[0817] Primer 98: 5'ATTACAGTTGTCGCAGGTGA 3' (SEQ ID NO:38)

[0818] Primer...

Embodiment 2

[0896] Purified FIX-CTP 3 Relative to FIX-CTP 4 and FIX-CTP 5 Comparative evaluation of

[0897] 2.1 Research purpose

[0898] FIX-CTP after partial purification process 4 and FIX-CTP 5 Relative to FIX-CTP 3 Comparative evaluation of pharmacokinetic parameters.

[0899] 2.2FIX-CTP 4 and FIX-CTP 5 harvest production

[0900] FIX cDNA (OriGene RC219065) fused at the C-terminus with 4 or 5 tandem CTP sequences was expressed in Dg44 cells using the Excell gene expression system in the presence of 10 ng / L vitamin K3 (Sigma, Mennadion). The harvest (300ml) was collected, filtered and frozen.

[0901] 2.3FIX-CTP 3 harvest production

[0902] Internal expression of FIX-CTP in CHO cells using pCI-DHFR vector clone 196, BR-9 in the presence of 25 ng / L vitamin K3 (Sigma) 3 . The harvest is collected and filtered.

[0903] All FIX-CTP samples (3, 4 and 5 CTPs) were purified only by Jacalin column due to lack of material.

[0904] 2.4 Determination of FIX antigen level

[...

Embodiment 3

[0936] FIX- / - FIX-CTP in the mouse model of hemophilia 3 treat

[0937] As mentioned above, experiments FIX-CTP, FIX-CTP 2 and FIX-CTP 3 Study of the PK profile and coagulation activity of the harvest relative to rhFIX. Relative to FIX-CTP 1 and FIX-CTP 2 Harvest or rhFIX, FIX-CTP 3 Exhibits an improved PK profile while maintaining its coagulation activity. To further evaluate this result, FIX-CTP was purified 3 Gamma-carboxyglutamic acid protein. After a single intravenous administration, compared with rhFIX in normal rats, FIX-CTP 3 Shows a 3-fold increase in half-life and a 4.5-fold increase in AUC. FIX-CTP 3 Exhibits reduced in vitro chromogenic and coagulation activity, most likely due to insufficient cleavage of the N-terminal propeptide and appropriate post-transcriptional modifications (PTMs), such as appropriate gamma carboxylation.

[0938] In the current study, the pharmacokinetic and pharmacodynamic properties of human recombinant FIX fused to three tand...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Polypeptides comprising at least one carboxy-terminal peptide (CTP) of chorionic gonadotrophin attached to the carboxy terminus but not to the amino terminus of a coagulation factor and polynucleotides encoding the same are disclosed. Pharmaceutical compositions comprising the polypeptides and polynucleotides of the invention and methods of using and producing same are also disclosed.

Description

technical field [0001] Polypeptides comprising at least one carboxy-terminal peptide (CTP) of chorionic gonadotropin linked to the carboxy-terminus of a coagulation factor and polynucleotides encoding them are disclosed. Also disclosed are pharmaceutical compositions comprising the polypeptides and polynucleotides of the invention and methods of using and producing them. Background technique [0002] The development of clotting factor replacement therapy has changed the lives of many individuals with hemophilia. Hemophilia is a group of inherited genetic disorders that impair the body's ability to control blood clotting, or clotting. Patients with hemophilia do not produce sufficient amounts of the Factor VIII or Factor IX proteins necessary for effective blood clotting. In severe hemophilia, even small injuries can cause blood loss that lasts for days or weeks and complete healing may not occur, leading to the possibility of debilitating permanent damage to joints and oth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K38/36A61K38/24C07K14/475A61P7/04
CPCC07K2319/31A61K38/24A61K38/4846C07K14/475C07K14/59A61P1/16A61P17/02A61P41/00A61P43/00A61P7/00A61P7/04A61K38/00C07K14/745
InventorU·E·菲马G·哈特
OwnerOPKO BIOLOGICS