Long-acting coagulation factors and methods of producing same
A technology for coagulation factors and factors, which can be used in coagulation/fibrinolytic factors, chemical instruments and methods, growth factors/inducing factors, etc., and can solve problems such as prolonging half-life
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0810] Preparation and Utilization of Coagulation Factor IX
[0811] Cloning and expression of recombinant FIX molecules:
[0812] Factor IX clones were constructed in our eukaryotic expression vector pCI-neo (Promega, catalog #E1841). An ORF clone of Homo sapiens coagulation factor IX was ordered from "OriGene" (RC219065). Order primers from Sigma-Genosys.
[0813] Construction of 301-1-pCI-neo-p200-11 (Factor IX-ctp x2):
[0814] Primer 101: 5'GTTTAGTGAACCGTCAGAAT 3' (SEQ ID NO:36)
[0815] Primer 103 R : 5'TTGAGGAAGATGTTCGTGTA 3' (SspI site containing Factor IX) (SEQ ID NO:37)
[0816] Primer 101 and Primer 103 R and plasmid DNA, a cDNA clone of Factor IX (OriGene" RC219065) (as a template), a PCR reaction was performed; as a result of PCR amplification, an approximately 1085 bp product (pcr 10) was formed and purified from a gel (containing the Factor IX sequence amino-terminal fragment).
[0817] Primer 98: 5'ATTACAGTTGTCGCAGGTGA 3' (SEQ ID NO:38)
[0818] Primer...
Embodiment 2
[0896] Purified FIX-CTP 3 Relative to FIX-CTP 4 and FIX-CTP 5 Comparative evaluation of
[0897] 2.1 Research purpose
[0898] FIX-CTP after partial purification process 4 and FIX-CTP 5 Relative to FIX-CTP 3 Comparative evaluation of pharmacokinetic parameters.
[0899] 2.2FIX-CTP 4 and FIX-CTP 5 harvest production
[0900] FIX cDNA (OriGene RC219065) fused at the C-terminus with 4 or 5 tandem CTP sequences was expressed in Dg44 cells using the Excell gene expression system in the presence of 10 ng / L vitamin K3 (Sigma, Mennadion). The harvest (300ml) was collected, filtered and frozen.
[0901] 2.3FIX-CTP 3 harvest production
[0902] Internal expression of FIX-CTP in CHO cells using pCI-DHFR vector clone 196, BR-9 in the presence of 25 ng / L vitamin K3 (Sigma) 3 . The harvest is collected and filtered.
[0903] All FIX-CTP samples (3, 4 and 5 CTPs) were purified only by Jacalin column due to lack of material.
[0904] 2.4 Determination of FIX antigen level
[...
Embodiment 3
[0936] FIX- / - FIX-CTP in the mouse model of hemophilia 3 treat
[0937] As mentioned above, experiments FIX-CTP, FIX-CTP 2 and FIX-CTP 3 Study of the PK profile and coagulation activity of the harvest relative to rhFIX. Relative to FIX-CTP 1 and FIX-CTP 2 Harvest or rhFIX, FIX-CTP 3 Exhibits an improved PK profile while maintaining its coagulation activity. To further evaluate this result, FIX-CTP was purified 3 Gamma-carboxyglutamic acid protein. After a single intravenous administration, compared with rhFIX in normal rats, FIX-CTP 3 Shows a 3-fold increase in half-life and a 4.5-fold increase in AUC. FIX-CTP 3 Exhibits reduced in vitro chromogenic and coagulation activity, most likely due to insufficient cleavage of the N-terminal propeptide and appropriate post-transcriptional modifications (PTMs), such as appropriate gamma carboxylation.
[0938] In the current study, the pharmacokinetic and pharmacodynamic properties of human recombinant FIX fused to three tand...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com