Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology
An RNA interference and blood lymphocyte technology, applied in the field of molecular biology RNA interference technology and application, can solve the problem of not finding specific activation of UPR and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0038] First, design and synthesize the primers for dsLvBip's forward ssRNA and reverse ssRNA templates, synthesize dsLvBip's ssRNA and reverse ssRNA through PCR reaction, and then form dsLvBip through denaturation and annealing. Inject dsLvBip into the second abdominal segment of Litopenaeus vannamei at a dose of 1μg / g body weight. 48-72 hours after injection, a sample of Litopenaeus vannamei blood lymphocytes was taken to extract total RNA, reverse transcribed into cDNA, and then the interference effect of total Bip gene (GenBank under accession No.JQ265942) and UPR activation of Litopenaeus vannamei blood lymphocytes were tested effect.
[0039] Design two pairs of primers to synthesize ssRNA and reverse ssRNA templates:
[0040] DsRNA-LvBip-482-T7-F1:
[0041] GGATCCTAATACGACTCACTATAGGTGTCGGTGGTTCCACTCGTA
[0042] DsRNA-LvBip-482-R1:CCTTGTTTCCTGTGCCCTTG
[0043] DsRNA-LvBip-482-F2:TGTCGGTGGTTCCACTCGTA
[0044] DsRNA-LvBip-482-T7-R2:
[0045] GGATCCTAATACGACTCACTATAGGCCTTGTTTCCTGTGC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap