Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology

An RNA interference and blood lymphocyte technology, applied in the field of molecular biology RNA interference technology and application, can solve the problem of not finding specific activation of UPR and so on

Inactive Publication Date: 2015-03-25
SUN YAT SEN UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To study the relationship between UPR and immune system of Litopenaeus vannamei, the relationship between UPR and virus infection, the relationship between UPR and cell cycle regulation, and the relationship between UPR and substance metabolism requires an effective and fast method for inducing UPR in Litopenaeus vannamei cells. However, a method to specifically activate the UPR in Litopenaeus vannamei has not been found so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology
  • Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology
  • Method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of RNA interference technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] First, design and synthesize the primers for dsLvBip's forward ssRNA and reverse ssRNA templates, synthesize dsLvBip's ssRNA and reverse ssRNA through PCR reaction, and then form dsLvBip through denaturation and annealing. Inject dsLvBip into the second abdominal segment of Litopenaeus vannamei at a dose of 1μg / g body weight. 48-72 hours after injection, a sample of Litopenaeus vannamei blood lymphocytes was taken to extract total RNA, reverse transcribed into cDNA, and then the interference effect of total Bip gene (GenBank under accession No.JQ265942) and UPR activation of Litopenaeus vannamei blood lymphocytes were tested effect.

[0039] Design two pairs of primers to synthesize ssRNA and reverse ssRNA templates:

[0040] DsRNA-LvBip-482-T7-F1:

[0041] GGATCCTAATACGACTCACTATAGGTGTCGGTGGTTCCACTCGTA

[0042] DsRNA-LvBip-482-R1:CCTTGTTTCCTGTGCCCTTG

[0043] DsRNA-LvBip-482-F2:TGTCGGTGGTTCCACTCGTA

[0044] DsRNA-LvBip-482-T7-R2:

[0045] GGATCCTAATACGACTCACTATAGGCCTTGTTTCCTGTGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for inducing blood lymphocyte of litopenaeus vannamei to generate UPR (unfolded protein response) by means of an RNA interference technology. The method comprises the following steps: (1) synthesizing dsLvBip with sequence specificity according to a cDNA sequence of a Bip gene of litopenaeus vannamei; and (2) diluting dsLvBip, controlling the injection volume at 50 mu L and injecting dsLvBip into the litopenaeus vannamei according a dosage of 1 mu g / g. The method provided by the invention can be used for simply, conveniently, rapidly, efficiently and specifically inducing blood lymphocyte of litopenaeus vannamei to generate UPR.

Description

Technical field [0001] The invention belongs to the field of molecular biology RNA interference technology and application, and specifically relates to a method for using RNA interference technology to knock down the Bip gene of Litopenaeus vannamei to induce UPR in blood lymphocytes. Background technique [0002] The prawn (Litopenaeus vannamei) in the marine invertebrate genus Penaeus is an important species of aquaculture in my country. In 2013, the global production of farmed shrimp reached 3.3 million tons, of which my country's production of farmed shrimp was 1.3 million tons, making it the world's largest shrimp farming country. my country mainly cultivates four species of prawns, Litopenaeus vannamei, Penaeus monodon, Fenneropenaeus chinensis and Marsupenaeus japonicus. Among them, Litopenaeus vannamei is the main cultured species. The 11 coastal provinces and cities across the country have farmed, accounting for about 90% of the total farmed shrimp production. [0003] Wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/89
Inventor 陈义烘张泽芝翁少萍何建国
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com