Unlock instant, AI-driven research and patent intelligence for your innovation.

Mutant of gamma-glutamine methylamine synthetase, and encoding gene, amino acid sequence and application of mutant

A technology of glutamine methylamine and mutants, which is applied in the field of enzyme mutants, can solve the problems of hindering synthetases and easy inactivation, and achieve the effects of releasing ATP inhibition, reducing reaction costs, and good catalytic effects

Active Publication Date: 2021-07-23
INNOBIO CORP LTD
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One of the reasons hindering the efficiency of microbial enzymatic production of theanine is that γ-glutamine synthetase is easily inactivated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant of gamma-glutamine methylamine synthetase, and encoding gene, amino acid sequence and application of mutant
  • Mutant of gamma-glutamine methylamine synthetase, and encoding gene, amino acid sequence and application of mutant
  • Mutant of gamma-glutamine methylamine synthetase, and encoding gene, amino acid sequence and application of mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Construction of embodiment 1 mutant

[0045] The theanine synthase gene gmas sequence derived from Methylovorus mays, codon-optimized sequence is SEQ ID NO.1, connected into plasmid pET28(a), and transformed into E.coliBL21 to obtain the original strain E. .coliBL21-pET28(a)-gmas named WT.

[0046] The method for obtaining the γ-glutamine methylamine synthetase mutant M69 comprises the steps of:

[0047] 1. Follow the QuickMutation TM Gene random mutation kit design primers and random mutation, the primer sequence is:

[0048] random-F: GATATACATATGAAGAGCCTGGAAG; SEQ ID NO.4;

[0049] random-R: cccaagcttGTAGAATTGAACATAGCGG; SEQ ID NO.5;

[0050] 2. Random mutation PCR reaction

[0051] The random mutation PCR reaction refers to the following table to set up the random mutation PCR reaction system:

[0052] Table 1

[0053] Reagent final concentration volume Double distilled water or MilliQ water - 12.2μL RandomMut buffer(10×) 1× 2μL ...

Embodiment 2

[0063] Theanine was prepared by biotransformation using the mutant M69 wet bacteria as a biocatalyst and using sodium glutamate and ethylamine hydrochloride as substrates. The catalytic system is 10L, and the catalytic system includes 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mMATP, 160mM sodium hexametaphosphate, and 60g / L of M69 wet cells and 40g / LPPK wet cells. The reaction system was reacted at 45°C in an aqueous solution with pH = 7. After the reaction, the cells were removed by centrifugation, and the samples were filtered with a 0.22 μm membrane to detect the production of theanine by HPLC. The maximum output of theanine is 372mM, which is 65g / L. The reaction time is 12h, and the production intensity is 5.42g / L / h, which is 2.88 times that of the original bacteria.

Embodiment 3

[0064] The influence of embodiment 3 temperature on enzyme property

[0065] Temperature can change the catalytic reaction speed of the enzyme, and can also lead to the reduction or inactivation of the enzyme protein activity. The optimal reaction temperature of unmutated WT and mutant M69 was determined simultaneously. Respectively placed at 30, 35, 40, 45, 50 ° C for 60 minutes. In a PBS solution with pH=7, the reaction system contained 50 mM sodium glutamate, 55 mM ethylamine, 40 mM magnesium chloride and 30 mM ATP and 15 g / L of gmas cells. The change of theanine in the reaction solution was regularly measured by HPLC, and the enzyme activity value of WT measured at 35°C was taken as 100%, and the relative enzyme activities at other temperatures were calculated. Experimental results such as figure 1 As shown, the optimum temperature of WT is 35°C, while that of M69 is around 45°C.

[0066] The unmutated WT and the mutant M69 were incubated at 35 and 45°C, and the enzyme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant of gamma-glutamine methylamine synthetase, and an encoding gene, amino acid and application of the mutant to production of theanine. Specifically, the mutant of the gamma-glutamine methylamine synthetase is obtained through a genetic engineering method. The optimum temperature of enzyme is increased by 10 DEG C while the thermal stability of the gamma-glutamine methylamine synthetase is improved, the mutant can play a very good catalytic effect without being in a buffer salt solution, and meanwhile, the theanine is efficiently synthesized by utilizing the mutant through a method of coupling polyphosphate kinase; and according to the method, adenosine triphosphate (ATP) regeneration can be implemented while the theanine is synthesize by catalysis, and an effective way is provided for enzymatic industrial production of the theanine.

Description

technical field [0001] The invention relates to an enzyme mutant, in particular to a mutant of gamma-glutamine methylamine synthetase, its coding gene, amino acid and its application in the production of theanine. Background technique [0002] L-theanine (L-theanine) belongs to amide compounds and is the most abundant free amino acid in tea, accounting for more than 50% of the total free amino acids. Theanine is the main component of tea aroma and taste, and its content plays a key role in the flavor and quality of tea. The property of theanine is relatively stable. The content of theanine will not change if the theanine solution is boiled for 5 minutes, or theanine is dissolved in a pH 3.0 solution and stored at 25°C for 12 months. Therefore, in the usual food processing and sterilization process, the properties of theanine will not change, and no toxicity was found in the toxicity test. [0003] L-theanine, as a safe functional active factor integrating multiple physiolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/00C12N15/52C12P13/04C12R1/19
CPCC12N9/93C12P13/04C12Y603/04012
Inventor 范超齐佳琨袁文杰袁堂国洪皓刘军吴文忠
Owner INNOBIO CORP LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More