Mutant of gamma-glutamine methylamine synthetase, and encoding gene, amino acid sequence and application of mutant
A technology of glutamine methylamine and mutants, which is applied in the field of enzyme mutants, can solve the problems of hindering synthetases and easy inactivation, and achieve the effects of releasing ATP inhibition, reducing reaction costs, and good catalytic effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Construction of embodiment 1 mutant
[0045] The theanine synthase gene gmas sequence derived from Methylovorus mays, codon-optimized sequence is SEQ ID NO.1, connected into plasmid pET28(a), and transformed into E.coliBL21 to obtain the original strain E. .coliBL21-pET28(a)-gmas named WT.
[0046] The method for obtaining the γ-glutamine methylamine synthetase mutant M69 comprises the steps of:
[0047] 1. Follow the QuickMutation TM Gene random mutation kit design primers and random mutation, the primer sequence is:
[0048] random-F: GATATACATATGAAGAGCCTGGAAG; SEQ ID NO.4;
[0049] random-R: cccaagcttGTAGAATTGAACATAGCGG; SEQ ID NO.5;
[0050] 2. Random mutation PCR reaction
[0051] The random mutation PCR reaction refers to the following table to set up the random mutation PCR reaction system:
[0052] Table 1
[0053] Reagent final concentration volume Double distilled water or MilliQ water - 12.2μL RandomMut buffer(10×) 1× 2μL ...
Embodiment 2
[0063] Theanine was prepared by biotransformation using the mutant M69 wet bacteria as a biocatalyst and using sodium glutamate and ethylamine hydrochloride as substrates. The catalytic system is 10L, and the catalytic system includes 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mMATP, 160mM sodium hexametaphosphate, and 60g / L of M69 wet cells and 40g / LPPK wet cells. The reaction system was reacted at 45°C in an aqueous solution with pH = 7. After the reaction, the cells were removed by centrifugation, and the samples were filtered with a 0.22 μm membrane to detect the production of theanine by HPLC. The maximum output of theanine is 372mM, which is 65g / L. The reaction time is 12h, and the production intensity is 5.42g / L / h, which is 2.88 times that of the original bacteria.
Embodiment 3
[0064] The influence of embodiment 3 temperature on enzyme property
[0065] Temperature can change the catalytic reaction speed of the enzyme, and can also lead to the reduction or inactivation of the enzyme protein activity. The optimal reaction temperature of unmutated WT and mutant M69 was determined simultaneously. Respectively placed at 30, 35, 40, 45, 50 ° C for 60 minutes. In a PBS solution with pH=7, the reaction system contained 50 mM sodium glutamate, 55 mM ethylamine, 40 mM magnesium chloride and 30 mM ATP and 15 g / L of gmas cells. The change of theanine in the reaction solution was regularly measured by HPLC, and the enzyme activity value of WT measured at 35°C was taken as 100%, and the relative enzyme activities at other temperatures were calculated. Experimental results such as figure 1 As shown, the optimum temperature of WT is 35°C, while that of M69 is around 45°C.
[0066] The unmutated WT and the mutant M69 were incubated at 35 and 45°C, and the enzyme...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap