Recombinant erythropoietin hepatocyte receptor a2 antagonist and its coding gene and application

An antagonist, hepatocyte technology, applied in cytokines/lymphokines/interferons, applications, genetic engineering, etc., can solve the problems of unsatisfactory results and achieve the effect of broad application prospects

Inactive Publication Date: 2018-04-10
PEKING UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the past period of time, although people have found many neuroprotective agents with good effects in animal experiments, the results in clinical trials are not satisfactory, so we need to analyze cerebral ischemia from more perspectives Mechanism of reperfusion injury and search for potential effective therapeutic drugs (Posada-Duque, R.A., G.E. Barreto and G.P. Cardona-Gomez, Protection after stroke: cellular effectors of neurovascular unitintegrity. Front Cell Neurosci, 2014.8: p.231.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant erythropoietin hepatocyte receptor a2 antagonist and its coding gene and application
  • Recombinant erythropoietin hepatocyte receptor a2 antagonist and its coding gene and application
  • Recombinant erythropoietin hepatocyte receptor a2 antagonist and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1 The design of ephrinA1 mimetic peptide

[0048] The purpose of the polypeptide design of the present invention is to find an antagonist of EphA2, and the mode of action of the antagonist is to compete with the natural ligand ephrinA1 of EphA2 for the binding site on the EphA2 receptor ( figure 1 ), thereby blocking the interaction between ephrinA1 and EphA2 receptors, thereby inhibiting the activation of EphA2. Therefore, the present invention uses ephrinA1 as the backbone to mutate, and retains the amino acid sequence for binding or replaces the amino acid sequence for activation to find a polypeptide that can interact with the EphA2 ligand binding site but has no activation effect itself.

[0049]1. The inventor of the present invention obtained the target gene (PDB ID: 3HEI) of the human ephrinA1 protein from the NCBI protein library website (http: / / www.ncbi.nlm.nih.gov / protein / P20827.2), and intercepted Amino acids related to binding were discarded, an...

Embodiment 2

[0054] Example 2 Synthesis of cDNA molecules encoding EM1-EM4 proteins

[0055] 1. Design the gene sequences encoding EM1-EM4 according to the preferred codons of Escherichia coli, as follows:

[0056] EM1

[0057] CATATGTATATTCTGTATCTGGTGGAACATGAAGAATATCAGCTGTGCCAGCCGCAGAGCAAAGATCAGGTGCGTTGGCAGTGCAATCGTCCGAGCGAAACATGGCCCGGAGAAACTGAGCGAGAAATTTCAGCGCTTTACGCCGTTTACCCTGGGCAAAGAATTTAAAGAAGGCCATAGCTATTATTATTAGCAAACCGGGCGGCAGCCTCGAG

[0058] EM2

[0059] CATATGTATATTCTGTATCTGGTGGAACATGAAGAATATCAGCTGTGCCAGCCGCAGAGCAAAGATCAGGTGCGTTGGCAGTGCAATCGTCCGAGCGCGAAACATGGCCCGGAGAAACTGAGCGAGAAATTTCAGAGCTGGCTGGCGTATCCGGGCGCGGTGAGCTATCGTGAAGGCCATAGCTATTATTATTAGCAAACCGGGCGGCAGCCTCGAG

[0060] EM3

[0061] CATATGTATATTCTGTATCTGGTGGGCGGCGGCAGCAGCGTGCGTTGGCAGTGCAATCGTCCGAGCGCGAAACATGGCCCGGAGAAACTGAGCGAGAAATTTCAGCGCTTTACGCCGTTTACCCTGGGCAAAGAATTAAAAGAAGGCCATAGCTATTATTATTAGCAAACCGGGCGGCAGCCTCGAG

[0062] EM4

[0063] CATATGTATATTCTGTATCTGGTGGAACATGAAGAATATCAGCTGTGCCAGCCGCAGAGCAAAGATCAGGTGCGTTGGCAGTG...

Embodiment 3

[0080] The construction of embodiment 3 expression vector

[0081] The experimental method in this experiment is mainly operated according to the product instructions provided by J. Sambrook and the company in "Molecular Cloning Experiment Guide" (third edition).

[0082] 1. The pET30a vector (purchased from Invitrogen) and the target fragment (cDNA synthesized in Example 2) were double digested with NdeI and XhoI;

[0083] 2. T4 ligase connection;

[0084] 3. Transform competent Escherichia coli E.coli tranT1, and screen positive clones with kanamycin medium;

[0085] 4. Cultivate positive bacteria;

[0086] 5. Extract and purify the plasmid, and the electrophoresis results of the recombinant plasmid after double enzyme digestion are as follows: Figure 4 As shown in , the shorter one in the figure is the target fragment, and the longer one is the plasmid fragment, indicating that the recombinant plasmid was successfully constructed;

[0087] 6. Further sequencing was car...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant erythropoietin-producing hepatocyte receptor A2 antagonist as well as coding genes and application thereof. The antagonist is a type of polypeptide, and has an amino acid sequence shown as SEQ ID NO.2. Besides, the invention further discloses a nucleotide sequence of the antagonist, and the nucleotide sequence is preferentially shown as SEQ ID NO.6. When a mouse middle cerebral artery occlusion model and a cell model are utilized for evaluating the pharmacological activity of the antagonist, the evaluation results show that the antagonist can antagonize an EphA2 receptor, and has relatively good effects of protecting a blood-brain barrier and relieving a cerebral ischemic injury. The antagonist provided by the invention is a novel technical measure for treating vasogenic cerebral edema and cerebral arterial thrombosis, and has a broad application prospect.

Description

technical field [0001] The present invention relates to an antagonist and its encoding gene and application, in particular to an antagonist of recombinant erythropoietin hepatic cell receptor A2 (EphA2) and its encoding gene and its use in antagonizing the EphA2 receptor and protecting the blood-brain barrier The application of the present invention belongs to the field of biotechnology. Background technique [0002] Stroke is one of the main diseases leading to human death in the world, and it is the main factor causing disability, among which ischemic stroke is about 80% (Moretti, A., F.Ferrari and R.F.Villa, Neuroprotection forischaemic stroke: current status and challenges. Pharmacol Ther, 2015.146: p.23-34.). The current mainstay of treatment for ischemic stroke is to restore blood flow with thrombolytic drugs, thereby preventing depolarization of the penumbra. Thrombolytic drugs, as the main treatment for stroke in the world at present, are limited by many factors: s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/52C12N15/19A61K38/19A61P9/10A61P25/00A61P7/10
CPCA61K38/00C07K14/52
Inventor王银叶高远晴朱元军刘晓岩张烨
OwnerPEKING UNIV