Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

285 results about "Ischemic injury" patented technology

An ischemic brain injury is damage to brain tissue that results from decreased oxygen supply. Examples include stroke or transient ischemic attack (TIA), which is when arteries supplying blood/oxygen get clogged by clots, any problem that affects breathing (breathing failure, choking, drowning), or poisonous gas exposure.

Devices and methods for interstitial injection of biologic agents into tissue

The current invention discloses a method for treating infracted / ischemic injury to a myocardium by injecting a substance into the myocardium. The injected substance helps to prevent negative adaptive remodeling by providing mechanical reinforcement or mechanical reinforcement combined with biological therapy. A number of substances for injection are disclosed, including multi component substances such as platelet gel, and other substances. The substances disclosed may contain additives to augment / enhance the desired effects of the injection. The invention also discloses devices used to inject the substances. The devices can include means for ensuring needles do not penetrate beyond a desired depth into the myocardium. The devices can also include needles having multiple lumens such that the components of the platelet gel will be combined at the injection site and begin polymerization in the myocardium.
Owner:MEDTRONIC INC

Treatment Of Peripheral Vascular Disease Using Postpartum-Derived Cells

InactiveUS20070160588A1BiocideGenetically modified cellsBlood flowPeripheral ischaemia
Compositions and methods of using cells derived from postpartum tissue such as the umbilical cord and placenta, to stimulate and support angiogenesis, to improve blood flow, to regenerate, repair, and improve skeletal muscle damaged by a peripheral ischemic event, and to protect skeletal muscle from ischemic damage in peripheral vascular disease patients are disclosed.
Owner:DEPUY SYNTHES PROD INC

Methods and compositions relating to modulation of A20

The invention provides compositions and methods for treating diseases characterized by aberrant programmed cell death and / or inflammation, comprising mediating A20 function in the subject. Such diseases include Crohn's disease, inflammatory bowel disease, a disease associated with ischemic injury, a toxin-induced liver disease and cancer. The invention further provides methods and compositions for assays for modulators of A20.
Owner:UNIVERSITY OF CHICAGO

Devices and methods for interstitial injection of biologic agents into tissue

The current invention discloses a method for treating infracted / ischemic injury to a myocardium by injecting a substance into the myocardium. The injected substance helps to prevent negative adaptive remodeling by providing mechanical reinforcement or mechanical reinforcement combined with biological therapy. A number of substances for injection are disclosed, including multi component substances such as platelet gel, and other substances. The substances disclosed may contain additives to augment / enhance the desired effects of the injection. The invention also discloses devices used to inject the substances. The devices can include means for ensuring needles do not penetrate beyond a desired depth into the myocardium. The devices can also include needles having multiple lumens such that the components of the platelet gel will be combined at the injection site and begin polymerization in the myocardium.
Owner:MEDTRONIC INC

Ischemic preconditioning

InactiveUS6103722AInduce effectAbolished hypotensionBiocideOrganic chemistryCardioprotectionHead injury sequelae
Methods and pharmaceutical compositions of matter are disclosed and claimed relating to cardioprotective effect mediated by delta ( delta ) opioid receptor agonists or more specifically delta-1 ( delta 1)-opioid receptor agonists. Further, methods drawn to reducing ischemic damage to organs and tissues having delta ( delta ) opioid receptor agonists or more specifically delta-1 ( delta 1)-opioid receptors are disclosed and claimed. Specifically, methods and pharmaceutical compositions of matter are taught as a means of providing cardioprotective treatment through the administration of delta ( delta ) opioid receptor agonists or more specifically delta-1 ( delta 1)-opioid receptor agonists, such as TAN67(-). Said methods and pharmaceutical compositions are envisioned as a means of reducing myocardial infarction arising from the onset and sequelae of myocardial ischemia.
Owner:THE MEDICAL COLLEGE OF WISCONSIN INC

Methods and Devices for Reducing Tissue Damage After Ischemic Injury

InactiveUS20090010987A1Improve efficiencyReduce ischemia-induced tissue damageStentsPeptide/protein ingredientsReperfusion injuryIschemic injury
Methods and devices are provided for the local delivery of anti-ischemic agents which reduce myocardial tissue damage due to ischemia or reperfusion, in combination with compounds that sensitize the response of the tissue to the anti-ischemic agent. The therapeutic agents are delivered to the myocardial tissue over an administration period sufficient to achieve reduction in ischemic or reperfusion injury of the tissue.
Owner:INNOVATIONAL HLDG LLC

Isoquinoline-1,3,4-trione compounds, the synthetic method and the use thereof

The invention relates to various substituted isoquinoline-1,3,4-trione, the synthetic method thereof and the use for treating neurodegenerative diseases, especially as the medicine for Alzheimer's disease, apoplexy and brain ischemic injuries.
Owner:SHANGHAI INST OF MATERIA MEDICA CHINESE ACAD OF SCI +1

System for exsanguinous metabolic support of an organ or tissue

InactiveUS20040038193A1Effectiveness of the invention in supporting the organ culture of various organs and tissues was evaluatedDead animal preservationFunctional integrityPerfusion
An exsanguinous metabolic support system for maintaining an organ or tissue at a near normal metabolic rate is disclosed. The system employs a warm perfusion solution capable of supporting the metabolism of the organ or tissue thereby preserving its functional integrity. The system also monitors parameters of the circulating perfusion solution, such as pH, temperature, osmolarity, flow rate, vascular pressure and partial pressure of respiratory gases, and regulates them to insure that the organ is maintained under near-physiologic conditions. Use of the system for long-term maintenance of organs for transplantation, for resuscitation and repair of organs having sustained warm ischemic damage, as a pharmaceutical delivery system and prognosticator of posttransplantation organ function is also disclosed.
Owner:BREONICS

Interstitial brain cooling probe and sheath apparatus

Disclosed is an apparatus and method for preventing secondary ischemic injury in the brain. The apparatus includes an interstitial brain probe and an introducer sheath, which are placed into an ischemic region of the brain by stereotaxic surgical technique. The interstitial brain probe and introducer sheath provide for thermal coagulation to provide hemostasis, aspiration of blood clots, infusion of therapeutic agents, and localized hypothermia within an ischemic region of the brain. The interstitial brain probe cools an ischemic region of the brain from within the ischemic region, and cooling is substantially limited to the ischemic region. Cooling is provided for a period of time greater than one hour.
Owner:MEDCOOL

Therapeutic methods for treating vascular eye disorders with DII4 antagonists

InactiveUS20080181893A1Inhibition of developmentEnhanced regrowthSenses disorderPeptide/protein ingredientsDiabetic retinopathyIschemic retinopathy
A therapeutic method for treating ischemic or vascular disorders by administering an agent capable of inhibiting human delta-like ligand 4 (Dll4) activity to a subject in need thereof. In one embodiment, the agent is an anti-Dll4 antibody or antibody fragment capable of inhibiting the binding of Dll4 to a Notch receptor. The method of the invention is useful for treating eye disorders such as ischemic retinopathy, diabetic retinopathy, age related macular degeneration, corneal neovascularization, neovascular glaucoma, or retinopathy of prematurity. The method is also useful or treating ischemic or vascular disorders such as ischemic injury, cerebral ischemia, cardiac ischemia, ischemic conditions affecting the limbs and other organs or tissues, arteriovenous malformations, wound healing, organ or tissue transplantation, placental insufficiency, arterial narrowing and occlusion, atherosclerosis, and systemic or pulmonary hypertension.
Owner:REGENERON PHARM INC

Method for treating brain ischemic injury through transplantation of human umbilical mesenchymal stem cells

A method for treating or preventing an ischemic brain injury or neurological damage due to ischemia in a subject includes transplanting a therapeutically effective amount of human umbilical mesenchymal stem cells (HUMSCs) obtained from Wharton's Jelly to the ischemic areas of the brain injury or the neurological damage of the subject. Recovery from neurological behavior deficits also is improved according by the method.
Owner:FU YU SHOW +1

Modulation of angiogenesis and wound healing

Methods of regulating angiogenesis, ischemic injury and / or wound healing by modulating the activity of leptin, particularly as mediated by the leptin receptor, and / or the interaction between leptin and the leptin receptor. Correspondingly, these methods can also be used to treat diseases mediated by angiogenesis, including wound healing, tumors and tumor metastasis, diabetic microangiopathy, retinal neovascularization, neovascularization of adipose tissue and fat metabolism, revascularization of necrotic tissue, enhancement or vascularization in microvascular transplants, and ovarian follicle maturation. Assays for identifying agents that modulate leptin and / or leptin receptor-mediated angiogenesis and / or wound healing and their use in treating angiogenesis-mediated diseases or conditions involving wound healing are also disclosed.
Owner:YALE UNIV

Substituted 5-membered ring compounds and their use

Compound of a compound of formula (1) or a salt, N-oxide, hydrate or solvate thereof, in the preparation of a composition for inhibition of HSP90 activity: wherein ring A is an aromatic or non-aromatic carbocyclic or heterocyclic ring having 5 ring atoms, for example 1,2,3-triazolyl or a 1,2,4-triazolyl or a tetrazolyl ring; and R1 R2 R3 are as defined in the specification are inhibitors of HSP90 and therefore of use in the treatment of, for example, cancers, viral disease, inflammatory diseases such as rheumatoid arthritis, asthma, multiple sclerosis, Type I diabetes, lupus, psoriasis and inflammatory bowel disease; cystic fibrosis angiogenesis-related disease such as diabetic retinopathy, haemangiomas, and endometriosis; or for protection of normal cells against chemotherapy-induced toxicity; or diseases where failure to undergo apoptosis is an underlying factor, or protection from hypoxia-ischemic injury due to elevation of Hsp70 in the heart and brain; scrapie / CJD, Huntingdon's and Alzheimer's disease.
Owner:VERNALIS (R&D) LTD +2

System for exsanguinous metabolic support of an organ or tissue

An exsanguinous metabolic support system for maintaining an organ or tissue at a near normal metabolic rate is disclosed. The system employs a warm perfusion solution capable of supporting the metabolism of the organ or tissue thereby preserving its functional integrity. The system also monitors parameters of the circulating perfusion solution, such as pH, temperature, osmolarity, flow rate, vascular pressure and partial pressure of respiratory gases, and regulates them to insure that the organ is maintained under near-physiologic conditions. Use of the system for long-term maintenance of organs for transplantation, for resuscitation and repair of organs having sustained warm ischemic damage, as a pharmaceutical delivery system and prognosticator of posttransplantation organ function is also disclosed.
Owner:BREONICS

Amelioration of ischemic damage using synthetic oxygen carriers

A method of ameliorating tissue damage resulting from hypoxia or ischemia by administering systemically a synthetic oxygen carrier to an individual having or suspected of having blood vessel obstruction is disclosed. A synthetic oxygen carrier in a physiologically acceptable vehicle, wherein the synthetic oxygen carrier comprises submicron sized particles capable of passing through emboli-obstructed blood vessels is also disclosed.
Owner:KEIPERT PETER E +3

Acquisition method for exosomes derived from human urinary cells and application

The invention provides an acquisition method for exosomes derived from human urinary cells. The acquisition method includes the steps that firstly, human urine source cells are separately cultured, a culture medium is collected, the culture medium of the human urine source cells is filtered through a 0.22-micrometer filter membrane, and then large cell fragments and other impurities are removed; then an organelle is centrifugally removed, and supernatant is reserved; a membrane capable of intercepting 100KD molecular weight is used, the exosomes in the supernatant are centrifugally intercepted, after interception, PBS is used for eluting the membrane, and an exosome concentrated solution is obtained. The exosomes can be used for preparing medicine with the effects of resisting apoptosis, promoting angiogenesis, restoring ischemia damage and promoting cell growth and used for treating skin defects, skin ulcers, pressure sores, bone defects, bone ununion, femoral head necrosis, renal injury, ischemic injury, spinal cord injury, islet damage, diabetes, complications of diabetes, Alzheimer's diseases and the like.
Owner:上海艾棵颂生物科技有限公司 +1

Heterocyclic amide compounds as protein kinase inhibitors

The present invention relates to novel heterocyclic amide compounds of Formula I: as disclosed herein or a pharmaceutically acceptable salt, solvate, ester, prodrug or stereoisomer thereof. Also disclosed are compositions comprising said compounds, and methods for using said compounds for treating or preventing a proliferative disease, an anti-proliferative disorder, inflammation, arthritis, a neurological or neurodegenerative disease, a cardiovascular disease, alopecia, a neuronal disease, an ischemic injury, a viral disease or a fungal disease.
Owner:MERCK SHARP & DOHME CORP

Remote end ischemia preadaptation therapeutic apparatus with function of measuring blood pressure

The invention provides a remote end ischemia preadaptation therapeutic apparatus with a function of measuring blood pressure. The remote end ischemia preadaptation therapeutic apparatus comprises a power supply unit, at least one inflatable arm band, at least one inflatable tube, at least one air pressure sensor and release valve, an inflator pump and a circuit module, wherein the at least one inflatable tube is correspondingly connected and communicated with the inflatable arm band; the inflatable tube is provided with the at least one air pressure sensor and the release valve; the inflator pump is communicated with the inflatable tube and is used for inflating the inflatable arm band; the circuit module is connected with the inflator pump and comprises an air pressure acquisition unit, a blood pressure measuring unit, a microprocessor unit and a driving control unit. Due to the implementation of the remote end ischemia preadaptation therapeutic apparatus with the function of measuring the blood pressure, the health status of the human body blood pressure can be monitored in the treatment and training process, and effects of preventing and treating thrombosis of brain tissues and heart tissues and ischemic injury are achieved.
Owner:郑才二 +2

Methods and compositions for preserving tissues and organs

ActiveUS20140030231A1Extend and preserve viabilityReduces reperfusionBiocideMicrobiological testing/measurementOrgan ViabilityMetabolic Suppression
The present invention generally relates to methods and compositions to determine viability of an organ for transplantation and other medical purposes. One aspect of the invention relates to a method for assessing the viability of an organ by measuring the energy parameters to determine the energy level of the organ by determining the stored cellular energy (e.g., ATP levels), and / or energy consumption over a particular time period of viability. The energy parameters can be compared to reference energy parameters as a highly accurate and reliable prediction of viable cell yield, and organ viability. Another aspect of the invention relates methods to preserve or extend the time period of viability of an organ any combination of (i) preservation perfusion of the organ to prevent ischemic damage, (ii) chemical metabolic suppression of the organ e.g., using metabolic suppressants, (iii) metabolic suppression by physical or environmental conditions, e.g., sub-zero non-freezing storage.
Owner:THE GENERAL HOSPITAL CORP

Methods and Devices for Reducing Tissue Damage After Ischemic Injury

Methods and devices are provided for the delivery of therapeutic agents which reduce myocardial tissue damage due to ischemia and anti-restenotic agents which inhibit restenosis following a cardiac procedure such as stent implantation. The anti-ischemia agents are delivered to the myocardial tissue over an administration period sufficient to achieve reduction in ischemic or reperfusion injury of the myocardial tissue. The anti-restenotic agents are delivered over an administration period sufficient to reduce the re-narrowing of a blood vessel following a cardiac procedure such as implantation of a device. Preferred anti-restenotic drugs are those that do not reduce the beneficial effects provided by the anti-ischemic drug, such as drugs that do not act on the mammalian target of rapamycin (mTOR).
Owner:INNOVATIONAL HLDG LLC

C-terminal modified oxamyl dipeptides as inhibitors of the ICE/ced-3 family of cysteine proteases

This invention is directed to novel oxamyl dipeptide ICE / ced-3 family inhibitor compounds. The invention is also directed to pharmaceutical compositions containing these compounds, as well as to the use of such compositions in the treatment of patients suffering inflammatory, autoimmune and neurodegenerative diseases, for the prevention of ischemic injury, and for the preservation of organs that are to undergo a transplantation procedure.
Owner:CONATUS PHARMA

Composition for treating and preventing ischemic damage

The present disclosure relates to a composition for treating and preventing an ischemic injury. More particularly, it relates to a composition containing a peptide derived from a telomerase, which is effective in treating and preventing an ischemic injury. The peptide according to the present disclosure, a peptide having 80% or more sequence identity with the amino acid sequence of the peptide or a peptide which is a fragment thereof, has a superior effect of treating and preventing an ischemic injury. Accordingly, a composition containing the peptide may be effectively used for an ischemic injury, particularly for an ischemic-reperfusion injury.
Owner:GEMVAX & KAEL +1

Compounds for treatment of ischemic injury

The present invention relates to microRNA (miRNA) compounds for use in the treatment of consequences of acute ischemia / reperfusion, a method for preparing miRNA compounds by using test ischemia-reperfusion, test preconditioning and test postconditioning of biological samples, use of the miRNA compounds in the preparation of pharmaceutical compositions having cytoprotective and / or anti-ischemic effect in ischemic cardiac diseases.
Owner:PHARMAHUNGARY 2000

Screening of agents for activity against ischemic myocardial insults

Integrin-linked kinase (ILK) and Akt / protein kinase B (PKB) are important mediators of signaling in cardiomyocytes and can both prevent damage and promote healing associated with ischemic injury to the heart. Thus, the present invention provides for methods of screening for agents that increase the expression of ILK and / or Akt / PKB. Methods of treatment based on such agents are also provided.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Peptide-Based Peroxidase Inhibitors and Methods of Using Same

ActiveUS20140194342A1Potent inhibitor of peroxidase activityImproving vascular functionNervous disorderMetabolism disorderNeutral Amino AcidsPeroxidase
The present invention provides peptide-based peroxidase inhibitors having the formula AA1-AA2-AA3, wherein AA1 is a positively charged, negatively charged or neutral amino acid, AA2 is a redox active amino acid, and AA3 is an amino acid possessing a reducing potential such that AA3 is capable of undergoing a redox reaction with a radical of amino acid AA2 or a retro or retro-inverso analog thereof. The result of such a combination is a highly effective inhibitor of peroxidase activity that has potent anti-inflammatory properties in widely diverse models of vascular disease and injury. Exemplary tripeptides effectively inhibit peroxidase mediated LDL oxidation, increase vasodilation in SCD mice, inhibit eosinophil infiltration and collagen deposition in asthma mice, inhibit acute lung injury, and decrease ischemic injury of the heart.
Owner:THE MEDICAL COLLEGE OF WISCONSIN INC

Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction

The invention discloses an application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction, wherein sequences of the miR-9-3p and miR-124-3p are shown as AUAAAGCUAGAUAACCGAAAGU and UAAGGCACGCGGUGAAUGCC. The exosomes in serum are precipitated by virtue of a high-molecular polyme, and the expression and differences of the brain tissue specific miR-9-3p and miR-124-3p in serum exosomes of a patient with stroke and a healthy person are analyzed by virtue of a real-time fluorescent quantitative polymerase chain reaction (PCR) technology. In the case of acute stroke, the brain tissue specific miR-9-3p and miR-124-3p enter peripheral blood in the form of the exosomes, with a level obviously increased in comparison with a control group, and expression quantities are positively correlated to a degree of brain injury; therefore, the miR-9-3p and miR-124-3p can be used as the markers for judging cerebral ischemic injury and degree.
Owner:广州爱索达生物医药技术有限公司

Treatment with Sigma Receptor Agonists Post-Stroke

A method of post-stroke treatment at delayed timepoints with sigma receptor agonists. Sigma receptors are promising targets for neuroprotection following ischemia. One of the key components in the demise of neurons following ischemic injury is the disruption of intracellular calcium homeostasis. The sigma receptor agonist, DTG, was shown to depress [Ca2+]i elevations observed in response to ischemia induced by sodium azide and glucose deprivation. Two sigma receptor antagonists, metaphit and BD-1047, were shown to blunt the ability of DTG to inhibit ischemia-evoked increases in [Ca2+]i. DTG inhibition of ischemia-induced increases in [Ca2+]i was mimicked by the sigma-1 receptor-selective agonists, carbetapentane, (+)-pentazocine and PRE-084, but not by the sigma-2 selective agonist, ibogaine, showing that activation of sigma-1 receptors is responsible for the effects. Activation of sigma receptors can ameliorate [Ca2+]i dysregulation associated with ischemia in cortical neurons, providing neuroprotective properties. The effects of 1,3-di-o-tolyguanidine (DTG), a high affinity sigma receptor agonist, as a potential treatment for decreasing infarct area at delayed time points was further examined in rats. DTG treatment significantly reduced infarct area in both cortical / striatal and cortical / hippocampal regions by >80%, relative to control rats. These findings were confirmed by immunohistochemical experiments using the neuronal marker, mouse anti-neuronal nuclei monoclonal antibody (NeuN), which showed that application of DTG significantly increased the number of viable neurons in these regions. Furthermore, DTG blocked the inflammatory response evoked by MCAO, as indicated by decreases in the number of reactive astrocytes and activated microglia / macrophages detected by immunostaining for glial fibrillary acidic protein (GFAP) and binding of isolectin IB4, respectively. Thus, the sigma receptor-selective agonist, DTG, can enhance neuronal survival when administered 24 hr after an ischemic stroke. In addition, the efficacy of sigma receptors for stroke treatment at delayed time points is likely the result of combined neuroprotective and anti-inflammatory properties of these receptors.
Owner:UNIV OF SOUTH FLORIDA