Application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction

Abstract

The invention discloses an application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction, wherein sequences of the miR-9-3p and miR-124-3p are shown as AUAAAGCUAGAUAACCGAAAGU and UAAGGCACGCGGUGAAUGCC. The exosomes in serum are precipitated by virtue of a high-molecular polyme, and the expression and differences of the brain tissue specific miR-9-3p and miR-124-3p in serum exosomes of a patient with stroke and a healthy person are analyzed by virtue of a real-time fluorescent quantitative polymerase chain reaction (PCR) technology. In the case of acute stroke, the brain tissue specific miR-9-3p and miR-124-3p enter peripheral blood in the form of the exosomes, with a level obviously increased in comparison with a control group, and expression quantities are positively correlated to a degree of brain injury; therefore, the miR-9-3p and miR-124-3p can be used as the markers for judging cerebral ischemic injury and degree.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and in particular relates to the application of serum exosome miR-9-3p and miR-124-3p as diagnostic markers for acute cerebral infarction. Background technique [0002] Stroke is one of the diseases with high morbidity and mortality worldwide, and is the leading cause of adult disability. It has the characteristics of "five highs", that is, high morbidity rate, high mortality rate, high disability rate, high recurrence rate, and high cost of diagnosis and treatment, causing a heavy economic burden to the country and patients' families. Ischemic stroke (IS) accounts for 80% of all strokes [Donnan GA, Fisher M, Macleod M, et al. Stroke [J]. Lancet, 2008, 371 (9624): 1612-1623.], Thrombolytic therapy using tissue plasminogen activator (t-PA) to recanalize the occluded blood vessels to rescue the ischemic penumbra is currently the most effective treatment, but this is limited by the narrow...

AI Technical Summary

Problems solved by technology

But they also lack tissue specificity, miR-145 is mainly distributed in vascular smooth muscle cells [Creemers EE, Tijsen AJ, Pinto YM. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease? [J]. Circ Res, 2012, 110(3): 483-495.] and miRNA-210 is an oxygen-sensitive microRNA [Creemers EE, Tijsen AJ, Pinto YM. Circulating microRNAs: novel biomarkers and extracellular communicators in cardiovascular disease? [J].Circ Res,2012,110(3):483-495.]

Images