Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chicken MDA5 gene promoter and application thereof

A promoter and promoter sequence technology, applied in the field of genetic engineering, can solve the problems of unclear regulation mechanism of MDA5 and no reports on research, and achieve the effect of convenient verification, prediction and easy screening.

Active Publication Date: 2015-09-09
GUANGXI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are many studies on the regulation mechanism of RIG-I, but the regulation mechanism of MDA5 is still unclear, and the study on the promoter of chicken MDA5 gene has not been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken MDA5 gene promoter and application thereof
  • Chicken MDA5 gene promoter and application thereof
  • Chicken MDA5 gene promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: chicken melanoma differentiation-associated gene 5 (MDA5) promoter fragment and corresponding acquisition

[0032] NCBI database (http: / / www.ncbi.nlm.nih.gov) searched the upstream regulatory sequence of chicken melanoma differentiation-related gene MDA5, predicted the approximate region of MDA5 promoter, and used this sequence as the research object. Design primers (the primer sequence is shown in Table 1), and use the white chicken genomic DNA as a template to amplify the promoter region of MDA5 by PCR. The amplified products are identified by 1% agarose gel electrophoresis and purified and recovered with Tiangen recovery kit , the fragment was connected to the pMD19-T (Takara) vector, and sent to the handsome company for sequencing. The obtained promoter sequence is shown in SEQ ID NO:3.

[0033] Primer name Primer sequence Fragment length (bp) MDA5 promoter AF TTCTGGAACGCTCTTTCCACA 2678 MDA5 promoter BR ...

Embodiment 2

[0034] Example 2: Construction of chicken melanoma differentiation-associated gene 5 (MDA5) promoter transfection vector

[0035]Using the MDA5 promoter connected to the pMD19-T vector as a template, primers were designed for PCR amplification, and two Dicer sites, PciⅠ and BamHI, were introduced. The sequences of the primers are shown in Table 2. The amplified product was identified by 1% agarose gel electrophoresis and purified and recovered with the Tiangen recovery kit, then connected to the pEASY-T1 vector with the full-type gold pEASY-T1 Cloning Kit kit, and sent to Yingjun Company sequencing. After sequence comparison, select the samples with correct sequencing for future use.

[0036] Table 2 Amplification primers introducing PciⅠ and BamHI restriction sites

[0037]

[0038] Use restriction endonucleases PciⅠ and BamHI (both purchased from NEB Company) to double-digest the vector pDsRed1-N1 plasmid (Clontech) and the promoter fragment connected to pEASY-T1 respec...

Embodiment 3

[0060] Example 3: Cell Transfection of Recombinant Plasmids

[0061] In this study, chicken embryonic fibroblasts (DF-1) were adherent cells, which were cultured by adherent cell culture method. The cells are passaged in culture dishes or well plates, cultured in a 37°C incubator with a carbon dioxide concentration of 5%, and the growth status of the cells, such as cell shape and density, is observed through a microscope. Under normal circumstances, subculture once every three days. The cell culture medium is DMEM high-glucose medium containing 10% fetal bovine serum and 0.01% penicillin-streptomycin solution.

[0062] Prior to cell transfection, transfer the cells into a 24-well plate to reach a density of 70-80% within 24 hours. Cell transfection was carried out by liposome method at about 24 hours. The liposome used was Lipofectamine® LTX & PLUS Reagent (Invitrogen), and the specific operation was carried out in strict accordance with the instructions.

[0063] About 36...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chicken MDA5 gene promoter. A sequence of the chicken MDA5 gene promoter is shown as SEQ ID NO:3 in a sequence table, and the sequence length of the MDA5 gene promoter is 2487bp. The invention also discloses a cloning method and application of the MDA5 gene promoter. According to the invention, the capability of the chicken MDA5 gene promoter in promotion of gene expression in cells is verified, and the regulation of different stimulants on promoter expression is verified, so that deeper cognition is provided for the regulation of expression of the MDA5 gene.

Description

[0001] technical field [0002] The invention belongs to the technical field of genetic engineering, and in particular relates to the isolation, identification and application of a promoter region of chicken natural immunity-related gene MDA5. Background technique [0003] Innate immunity, also known as non-specific immunity or innate immunity, mainly realizes the removal and killing of pathogens through natural immune molecules and cells 。 Through the recognition of pathogens, host cells activate a series of downstream cascade reactions, which eventually lead to the production of type I interferons, pro-inflammatory cytokines, chemokines, etc., thereby inhibiting the replication of pathogens, resisting infection and clearing pathogens. The recognition of innate immunity to pathogens depends on pathogen molecular pattern recognition receptors (PRR) 。 [0004] Melanoma Differentiation-Associated protein 5 (MDA5, also known as Helicard, IFIH1) is a pathogen molecular pat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/10C12N15/55C12N15/85
Inventor 陆阳清张文馨陈东阳左二伟卢克焕
Owner GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com