CAD gene of eucalyptus urophylla and application thereof
A technology of Eucalyptus urophylla and genes, applied in the field of plant genetic engineering, can solve the problems that genetic engineering regulation has not yet been carried out, and achieve the effect of directional regulation of lignin content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Eucalyptus urophylla CAD Gene cDNA sequence cloning
[0024] Reported in other plants searched by NCBI CAD Gene sequence, blast analysis of the conserved region of the gene, using Vector NTI software to design the target gene-specific primers CAD-F / CAD-R, the sequence is as follows:
[0025] CAD-F: CTTTGAGCAAAAATGGGCAGTCTTG;
[0026] CAD-R: GGGAAAGGACAAAACTAATCAAGC.
[0027] The stem tissues of Eucalyptus urophylla GLU4 clone tissue-cultured seedlings transplanted and cultured for 3 to 4 weeks were extracted, and total RNA was extracted with RNA prep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TAKARA), and RNA LA PCR reverse transcription reagent was used to extract total RNA. The kit (TAKARA) was used to synthesize cDNA, all of which were operated according to the instructions of the kit, and the DNA samples were stored at -80°C.
[0028] Using cDNA as a template, target gene-specific primers CAD-F / CAD-R were used to amplify gene c...
Embodiment 2
[0029] Embodiment 2, Eucalyptus urophylla CAD Gene RNAi expression vector construction
[0030] By means of PCR amplification, restriction endonuclease digestion, target fragment recovery and ligation, etc., the CAD The genes are assembled into RNAi fragments in a "tail-to-tail" manner and cloned into a plant expression vector, such as pBI121, so that the gene is under the control of a promoter such as the CaMV 35S promoter.
[0031] Implement according to the following method of operation, and the detailed steps can be modified according to methods known to those skilled in the art:
[0032] Primers CAD-F1 / CAD-R were designed according to the CAD gene sequence to amplify the CDS region of the gene, and the primer CAD-F1 was appended Bam HI restriction site (underlined sequence), the sequence is as follows:
[0033] CAD-F1: GGATCC CTTTGAGCAAAAATGGGCAGTCTTG;
[0034] CAD-R: GGGAAAGGACAAAACTAATCAAGC.
[0035] Use pCAD-1 as template, use CAD-F1 and CAD-R primers Ex-Taq ...
Embodiment 3
[0045] Embodiment 3: Utilize Eucalyptus urophylla CAD Gene regulation of tobacco lignin synthesis
[0046] Using conventional methods, the pBI121-CAD recombinant vector was introduced into Agrobacterium LBA4404, and positive strains were obtained through antibiotic plate screening, PCR identification and sequencing identification. According to the conventional method, Agrobacterium bacterium liquid infects tobacco leaves, and after co-cultivation, differentiation, strong seedlings, rooting, transplanting and other stages of cultivation, transgenic tobacco seedlings are obtained.
[0047] Eight weeks after transplanting, the leaves of the seedlings were collected to extract the total DNA, and the seedlings were identified by PCR with specific primers CAD-F / CAD-R, and the plants corresponding to the samples that could successfully amplify a band of about 1100 bp could be determined as positive transgenes plants.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap