Supercharge Your Innovation With Domain-Expert AI Agents!

CAD gene of eucalyptus urophylla and application thereof

A technology of Eucalyptus urophylla and genes, applied in the field of plant genetic engineering, can solve the problems that genetic engineering regulation has not yet been carried out, and achieve the effect of directional regulation of lignin content

Inactive Publication Date: 2018-09-28
GUANGXI FORESTRY RES INST
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, in Eucalyptus urophylla no CAD The report of the gene sequence, the use of the gene sequence to carry out genetic engineering regulation has not yet been carried out

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CAD gene of eucalyptus urophylla and application thereof
  • CAD gene of eucalyptus urophylla and application thereof
  • CAD gene of eucalyptus urophylla and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Eucalyptus urophylla CAD Gene cDNA sequence cloning

[0024] Reported in other plants searched by NCBI CAD Gene sequence, blast analysis of the conserved region of the gene, using Vector NTI software to design the target gene-specific primers CAD-F / CAD-R, the sequence is as follows:

[0025] CAD-F: CTTTGAGCAAAAATGGGCAGTCTTG;

[0026] CAD-R: GGGAAAGGACAAAACTAATCAAGC.

[0027] The stem tissues of Eucalyptus urophylla GLU4 clone tissue-cultured seedlings transplanted and cultured for 3 to 4 weeks were extracted, and total RNA was extracted with RNA prep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (TAKARA), and RNA LA PCR reverse transcription reagent was used to extract total RNA. The kit (TAKARA) was used to synthesize cDNA, all of which were operated according to the instructions of the kit, and the DNA samples were stored at -80°C.

[0028] Using cDNA as a template, target gene-specific primers CAD-F / CAD-R were used to amplify gene c...

Embodiment 2

[0029] Embodiment 2, Eucalyptus urophylla CAD Gene RNAi expression vector construction

[0030] By means of PCR amplification, restriction endonuclease digestion, target fragment recovery and ligation, etc., the CAD The genes are assembled into RNAi fragments in a "tail-to-tail" manner and cloned into a plant expression vector, such as pBI121, so that the gene is under the control of a promoter such as the CaMV 35S promoter.

[0031] Implement according to the following method of operation, and the detailed steps can be modified according to methods known to those skilled in the art:

[0032] Primers CAD-F1 / CAD-R were designed according to the CAD gene sequence to amplify the CDS region of the gene, and the primer CAD-F1 was appended Bam HI restriction site (underlined sequence), the sequence is as follows:

[0033] CAD-F1: GGATCC CTTTGAGCAAAAATGGGCAGTCTTG;

[0034] CAD-R: GGGAAAGGACAAAACTAATCAAGC.

[0035] Use pCAD-1 as template, use CAD-F1 and CAD-R primers Ex-Taq ...

Embodiment 3

[0045] Embodiment 3: Utilize Eucalyptus urophylla CAD Gene regulation of tobacco lignin synthesis

[0046] Using conventional methods, the pBI121-CAD recombinant vector was introduced into Agrobacterium LBA4404, and positive strains were obtained through antibiotic plate screening, PCR identification and sequencing identification. According to the conventional method, Agrobacterium bacterium liquid infects tobacco leaves, and after co-cultivation, differentiation, strong seedlings, rooting, transplanting and other stages of cultivation, transgenic tobacco seedlings are obtained.

[0047] Eight weeks after transplanting, the leaves of the seedlings were collected to extract the total DNA, and the seedlings were identified by PCR with specific primers CAD-F / CAD-R, and the plants corresponding to the samples that could successfully amplify a band of about 1100 bp could be determined as positive transgenes plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CAD gene of eucalyptus urophylla and application thereof. The nucleotide sequence of the CAD gene of the eucalyptus urophylla is as shown in SEQ ID No.1, the gene can be applied to transgenic plants, and it is proved that the gene has the function of adjusting and controlling lignin synthesis. The study of the function of the CAD gene of the eucalyptus urophylla is conducive to promoting the genetic engineering breeding of transgenic directional adjustment and control of lignin synthesis by the eucalyptus caudate.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to Eucalyptus urophylla CAD Genes and their applications. Background technique [0002] Eucalyptus is the general name of Eucalyptus in Myrtaceae, and its origin is Australia. Eucalyptus research in Guangxi is in a leading position in my country. The introduction of eucalyptus species began in the early 1970s. After years of introduction tests and cross-breeding, many excellent tree species, excellent provenances and excellent families have been obtained. Eucalyptus grows fast and has good materials. The area of ​​eucalyptus in Guangxi ranks first in the country, and it has become the main afforestation tree species of short-cycle raw material forest. Eucalyptus urophylla GLU4 clone ( Eucalyptus urophylla cloneGLU4) is a fine eucalyptus species widely planted in Guangxi, because its cellulose content, cellulose length and other pulping indicators are significa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N15/82C12N1/21C12N5/10A01H5/00A01H6/82
Inventor 陈博雯李军集肖玉菲刘海龙覃子海张烨张晓宁
Owner GUANGXI FORESTRY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More