Unlock instant, AI-driven research and patent intelligence for your innovation.

Primers and method for detecting c-kit gene mutation

A gene and detection result technology, which is applied in the field of primers for detection of c-kit gene mutations, can solve the problems of non-coverage and complicated experimental operations, and achieve the effects of good accuracy, improved detection efficiency, and high sensitivity

Inactive Publication Date: 2015-12-16
GUANGZHOU KINGMED DIAGNOSTICS CENT
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Chinese patent application 201410606037.9 discloses primers and probes for detecting c-kit gene mutations. The primers and probes are aimed at at least one mutation type in exons 9, 11, 13 and 17 of c-kit gene, and are carried out by fluorescent PCR. Amplification, purification of the product and sequencing analysis, the primers and probes cannot cover all mutations in exons 9, 11, 13 and 17 of the c-kit gene, and the experimental operation of this method is complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and method for detecting c-kit gene mutation
  • Primers and method for detecting c-kit gene mutation
  • Primers and method for detecting c-kit gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Primer

[0025] The inventors designed a large number of primers for c-kit gene exon 8 and c-kit gene exon 17, and selected primers with good specificity through optimization and comparison of primer reaction conditions.

[0026] Table 1 Primers provided by the present invention

[0027] c-kit-X8-F TGTAAAACGACGGCCAGTTTCAGATTCTGCCCTTTGAACTTG (SEQ ID NO. 1) c-kit-X8-R CAGGAAACAGCTATGACCTGAAATTCAAGTGAATTGCAGTCC (SEQ ID NO. 2) c-kit-X17-F TGTAAAACGACGGCCAGTTGGTTTTTCTTTTTCTCTCCAA (SEQ ID NO. 3) c-kit-X17-R CAGGAAACAGCTATGACCTGCAGGACTGTCAAAGCAGAG (SEQ ID NO. 4)

Embodiment 2

[0028] The specificity of embodiment two primers

[0029] The primers provided by the present invention were used for blasting in UCSC. The amplified fragment of exon 8 of c-kit gene was located between chr4:55589610-55589931, with a length of 322bp; the amplified fragment of exon 17 of c-kit gene was located at chr4:55599207 Between -55599391, the length is 185bp. No other homologous genes, the results are as follows Figure 1 to Figure 2 As shown, it is consistent with the c-kit gene reference sequence.

[0030] The primers in Table 1, the PCR amplification system in Table 2 and the PCR amplification conditions in Table 3 are used to amplify the detection sample, and the amplified product is analyzed by gel electrophoresis. The results are as follows image 3 shown. The results showed that the specificity of the amplified product was high, and no non-specific amplified bands were generated.

Embodiment 3

[0031] Example 3 Detection of c-kit gene mutation

[0032] Extract DNA samples from EDTA-anticoagulated peripheral blood. The extraction method refers to the instructions of TIANampBloodDNAKit (purchased from Tiagen, product number: DP318). The DNA samples are diluted to 100ng / μL and set aside.

[0033] PCR amplification using Q5 ? Hot start ultra-fidelity 2XMasterMix (purchased from NEB Company, item number: M0494L), the PCR amplification system is shown in Table 2, and the PCR amplification conditions are shown in Table 3. The concentration ratio of the upstream primer of exon 8, the downstream primer of exon 8, the upstream primer of exon 17 and the downstream primer of exon 17 is 1:1:1:1, and the concentration of the upstream primer of exon 8 , the downstream primer concentration of exon 8, the upstream primer concentration of exon 17 and the downstream primer concentration of exon 17 are all 10 p / mol.

[0034]

[0035]

[0036] Gel electrophoresis analysis was p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides primers for detecting c-kit gene mutation, and the primers include a forward primer and a backward primer for exon 8 and a forward primer and a backward primer for exon 17. The invention belongs to the technical field of biological detection, and the primers provided by the invention can specifically detect c-kit gene exons 8 and 17 mutations, and the specificity of the primers is good, and the accuracy is high, and the efficiency of the detection is increased.

Description

Technical field [0001] The present invention is a biological test technology field, and especially involves a primer and method that detects the C-KIT gene mutation. Background technique [0002] Primary cancer gene C-KIT gene is located in human chromosomal 4Q11-12, encoding 145kd transgender protein CD117, which belongs to the family of Class Ⅲ tyrosine kinase receptor family.The mutation of the C-KIT gene may cause continuous activation of tyrosine kinase that does not rely on ligands, thereby causing disorders of downstream signal pathways and leading to disease. [0003] Acute marrow leukemia (AML) is characterized by bone marrow and peripheral blood primitive and naive marrow cell abnormal hyperplasia. There is currently no exact cause, but it maySpecial reactions caused by virus infections.According to statistics, about 8%of patients with acute myeloid leukemia have mutations in the C-KIT gene, and the C-KitThe incidence of mutations 8 and 17 of genes 8 and 17, the main mu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/106C12Q2600/118C12Q2600/156
Inventor 燕启江赵薇薇于世辉梁耀铭胡昌明
Owner GUANGZHOU KINGMED DIAGNOSTICS CENT