Fusion expression and purification method for recombinant proteins by aid of alkaline tags and intein

A technology for expressing, purifying and fusion proteins, which can be used in chemical instruments and methods, recombinant DNA technology, animal/human proteins, etc., and can solve the problems of difficult industrial production, low enzyme digestion efficiency, and high cost.

Inactive Publication Date: 2016-02-10
SHANGHAI JIAO TONG UNIV +1
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the most commonly used method for removing tags is enzymatic digestion, including kinases, factor Xa, etc., but the application of enzymes has problems such as high cost, low efficiency of enzymatic digestion, and subsequent removal of the enzyme itself, making it difficult to achieve large-scale industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion expression and purification method for recombinant proteins by aid of alkaline tags and intein
  • Fusion expression and purification method for recombinant proteins by aid of alkaline tags and intein
  • Fusion expression and purification method for recombinant proteins by aid of alkaline tags and intein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1H

[0062] Example 1 His fusion with ΔI-CM to express Interleukin

[0063] The His gene sequence used in this experiment is as shown in SEQ ID NO.5, specifically:

[0064] CACCATCATCATCATCAT. According to the information of JBacteriol (1991) 173 (18): 5653-5662 and BiotechnolProg, 2000, 16: 1055-1063, the transformed form ΔI-CM of MtuRecAintein is obtained, and the coding gene sequence of the ΔI-CM is shown in SEQ ID NO.2 ). ΔI-CM is one of the most studied inteins at present. Its activity is the highest at pH 6.0-6.5, and it has C-terminal cleavage activity. Therefore, the target protein Interleukin (interleukin) fused and expressed at the C-terminus can be released separately to obtain Zbasic- Intein and Interleukin two parts. The coding gene sequence of Interleukin (interleukin-15) is shown in SEQ ID NO.3.

[0065] The genes of His, ΔI-CM and Interleukin were cloned and connected together by bridge PCR, and the obtained His-ΔI-CM-Interleukin was sequenced from the N-termina...

Embodiment 2Zba

[0070] Example 2 Zbasic and ΔI-CM fusion tag express Interleukin

[0071] (1) Construction of Zbasic and ΔI-CM fusion tag expression vector and host bacteria

[0072] According to the information reported in the document JChromatogrA (2002) 942 (1-2): 157-66, the DNA sequence of Zbasic was synthesized (Nanjing GenScript Co., Ltd.), and the coding gene sequence of Zbasic is shown in SEQ ID NO.1.

[0073] According to the information of JBacteriol (1991) 173 (18): 5653-5662 and BiotechnolProg, 2000, 16: 1055-1063, the transformed form ΔI-CM of MtuRecAintein is obtained, and the coding gene sequence of the ΔI-CM is shown in SEQ ID NO.2 . ΔI-CM is one of the most studied inteins at present. Its activity is the highest at pH 6.0-6.5, and it has C-terminal cleavage activity. Therefore, the target protein Interleukin (interleukin) fused and expressed at the C-terminus can be released separately to obtain Zbasic- Intein and Interleukin two parts. The coding gene sequence of Interle...

Embodiment 3

[0084] Example 3 MBP and ΔI-CM fusion tag expresses Interleukin

[0085] (1) Construction of MBP and ΔI-CM fusion tag expression vector and host bacteria

[0086] The gene expression sequence of MBP is cloned from the carrier pMAL-p2X of NEB Company (NewEngland Biolabs), and the coding gene sequence of the MBP is shown in SEQ ID NO.7, specifically:

[0087] ATGAAAATAAAAACAGGTGCACGCATCCTCGCATTATCCGCATTAACGACGATGATGTTTTCCGCCTCGGCTCTCGCCAAAATCGAAGAAGGTAAACTGGTAATCTGGATTAACGGCGATAAAGGCTATAACGGTCTCGCTGAAGTCGGTAAGAAATTCGAGAAAGATACCGGAATTAAAGTCACCGTTGAGCATCCGGATAAACTGGAAGAGAAATTCCCACAGGTTGCGGCAACTGGCGATGGCCCTGACATTATCTTCTGGGCACACGACCGCTTTGGTGGCTACGCTCAATCTGGCCTGTTGGCTGAAATCACCCCGGACAAAGCGTTCCAGGACAAGCTGTATCCGTTTACCTGGGATGCCGTACGTTACAACGGCAAGCTGATTGCTTACCCGATCGCTGTTGAAGCGTTATCGCTGATTTATAACAAAGATCTGCTGCCGAACCCGCCAAAAACCTGGGAAGAGATCCCGGCGCTGGATAAAGAACTGAAAGCGAAAGGTAAGAGCGCGCTGATGTTCAACCTGCAAGAACCGTACTTCACCTGGCCGCTGATTGCTGCTGACGGGGGTTATGCGTTCAAGTATGAAAACGGCAAGTACGACATTAAAGACGTGGGCGTGGATAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnologies, and particularly discloses a fusion expression and purification method for recombinant proteins by the aid of alkaline tags and intein and application of the fusion expression and purification method. The fusion expression and purification method and the application have the advantages that fusion expression can be carried out on the to-be-studied target proteins, the intein with a self-splicing function and the alkaline tags, and accordingly the target proteins can be quickly purified by means of ion exchange chromatography; exogenous enzymes can be omitted by the fusion expression and purification method as compared with the traditional methods, the ion exchange cost is low, and accordingly the fusion expression and purification method has an excellent application prospect in industrial production on enlarged scales.

Description

technical field [0001] The invention relates to the field of biotechnology, and specifically discloses a method for expressing and purifying a recombinant protein by fusion of a basic tag and an intein and an application thereof. Background technique [0002] Recombinant protein products such as enzymes, proteins, and antibodies play an indispensable role in people's production, life, and medical treatment. In particular, biotechnology drugs such as recombinant proteins and monoclonal antibodies are the latest generation of drugs that emerged with the development of life sciences in the late 20th century. They have a series of advantages such as high efficiency, low toxicity, and clear biological functions. The growth rate is maintained at 15% to 33%, and it has become a strategic pillar industry in my country. [0003] However, there are still considerable technical difficulties in the expression and purification process of recombinant proteins, which are far from meeting p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/70C12N15/62C07K19/00C07K14/54C07K1/18
Inventor路慧丽朱建伟张蕾江华谢跃庆史斯玮丁凯陈俊升韩雷李宁环
OwnerSHANGHAI JIAO TONG UNIV