Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection

A technology of Mycobacterium tuberculosis and reagent kits, applied in the field of molecular biology, can solve problems affecting detection specificity and achieve high accuracy, low cost, and easy promotion

Inactive Publication Date: 2016-03-02
SHIHEZI UNIVERSITY
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the synonymous mutation in the rifampicin resistance-determining region in the ropB gene of the strain may be the main reason for affecting the detection specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection
  • Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection
  • Primer for tubercle bacillus rifampicin drug-resistant fast detection and kit for tubercle bacillus rifampicin drug-resistant fast detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: refer to figure 1 , is the experimental result of Example 1 of the present invention.

[0032] The experimental plan is as follows:

[0033] 1. Test method:

[0034] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.

[0035] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.

[0036] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.

[0037] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the first set of primers:

[0038] rpoBForwarD: CGCCGCGATCAAGGAGTTC and rpoBReverse: 0.5ul each of GCCCGGCACGCTCATGT; DNA template: 1ul)

[0039] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extensio...

Embodiment 2

[0044] Embodiment 2: refer to figure 2 , is the experimental result of Example 2 of the present invention.

[0045] The experimental plan is as follows:

[0046] 1. Test method:

[0047] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.

[0048] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.

[0049] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.

[0050] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the second set of primers:

[0051] rpoB-F: AGCCAGCTGAGCCAATTCAT and rpoB-R: 0.5ul each of GCCCGGCACGCTCACGT; DNA template: 1ul)

[0052] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extension at 72°...

Embodiment 3

[0057] Embodiment 3: refer to image 3 , is the experimental result of Example 3 of the present invention.

[0058] The experimental plan is as follows:

[0059] 1. Test method:

[0060] (1) Use an inoculation loop to scrape the bacteria that grow well on the modified Roche medium, put them into the EP tube with TEbuffer, and inactivate them in a metal bath at 85°C for 45 minutes.

[0061] (2) Extract the DNA of various strains according to the instructions of the column Mycobacterium DNAout kit.

[0062] (3) Measure the DNA concentration and dilute to 10ug / ml according to different concentrations.

[0063] Reaction system: total volume 10ul (HRMMix: 5ul; MgCl 2 : 1.2ul; H 2 O: 2.3ul; the third set of primers: rpoB516-F: AGGAGTTCTTCGGCACCAG and rpoB516-R: 0.5ul each of GCACGCTCACGTGACAGAC; DNA template: 1ul)

[0064] Reaction parameters: pre-denaturation at 95°C for 10min; denaturation at 95°C for 10s; annealing at 62°C for 15s; sectarget at 53°C; extension at 72°C for 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for tubercle bacillus rifampicin drug-resistant fast detection and a kit for tubercle bacillus rifampicin drug-resistant fast detection. The primer comprises at least one group of following primers: the first group: rpoBForwarD: CGCCGCGATCAAGGAGTTC and rpoBReverse: GCCCGGCACGCTCATGT; the second group: rpoB-F: AGCCAGCTGAGCCAATTCAT and rpoB-R: GCCCGGCACGCTCACGT; and the third group: rpoB516-F: AGGAGTTCTTCGGCACCAG and rpoB516-R: GCACGCTCACGTGACAGAC.

Description

technical field [0001] The invention relates to the research and development of a biological detection reagent, in particular to a primer and a kit for rapid detection of rifampicin resistance of Mycobacterium tuberculosis, belonging to the technical field of molecular biology. Background technique [0002] Since its invention in 1971, rifampicin has been one of the key drugs in the anti-tuberculosis chemotherapy regimen, which can shorten the course of tuberculosis treatment. Mycobacterium tuberculosis resistance to rifampicin often leads to prolonged treatment, poor prognosis and even failure of chemotherapy. The key to the treatment of tuberculosis is to quickly detect and obtain drug resistance information of strains, and to design and adjust clinical chemotherapy regimens in time. At present, the conventional "gold standard" solid medium drug susceptibility detection method is to inoculate the strain on a solid medium containing the drug to be tested for cultivation, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/32
CPCC12Q1/689
Inventor陈创夫曹旭东杨敏袁俐于潞杨彩虹张辉包海洋吴长新
OwnerSHIHEZI UNIVERSITY