Reagent for legionella pneumophila detection according to in-vitro nested loop-mediated isothermal amplification method and legionella pneumophila detection method
A ring-mediated isothermal and Legionella pneumophila technology, which is applied in the determination/testing of microorganisms, resistance to vector-borne diseases, biochemical equipment and methods, etc., can solve the problems of low sensitivity and specificity, and achieve high specificity , the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Detection of Legionella pneumophila.
[0029] Primer design.
[0030] According to the conserved sequence of the mip gene of Legionella pneumophila, a series of primers were designed, including outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer Loop-f, loop primer Loop-r, set of primers FNP, Set of primers BNP. The primer gene sequence is as follows:
[0031] Outer primer F3: GCTGCAACCGATGCCACA;
[0032] Outer primer B3: TTGGGCCAATAGGTCCGC;
[0033] Inner primer FIP:
[0034] TTGCTGTTCGGTTAAAGCCAATTGTTGTCTTATAGCATTGGTGCCG;
[0035] Inner primer BIP:
[0036] ACTGAAAACAAAAACAAAGCCAGGCGCGTTGCTGGCTTACCAGTTT;
[0037] Loop primer Loop-f: CATGCAAGACGCTATGAGTGG;
[0038] Loop primer Loop-r: CGGGTTTAACACCATTTCCA;
[0039] Set of primers for FNP:
[0040] TTCAGCAGTACGCTTAGCCATCAAAATCAAGGCATAGATGTTAATCCG;
[0041] Set of primers for BNP:
[0042] AAGCGGATGAAAATAAAGTAAAAGGGCCATCAATCAGACGACCAGTAT.
[0043] Among the above prime...
Embodiment 2
[0058] Example 2, detection of Legionella pneumophila in environmental samples.
[0059] Use 20 copies of bacteria stored on magnetic beads separated from air-conditioned water samples, take out the magnetic beads for culture, pick colonies, and extract DNA according to the instructions of the extraction kit. The reaction system is as follows: 10×buffer 2.5 μL, primer mixture 1 μL (primer mixture The concentrations of the primers in the medium are as follows: 1 μmol / L for each of F3 and B3, 15 μmol / L for each of FIP and BIP, 5 μmol / L for each of Loop-f and Loop-r, 15 μmol / L for each of FNP and BNP), 1 μL of template DNA, 8 UBstDNA polymerase 1 μL, betaine (8mol / L) 2 μL, dNTP (10mmol / L) 2 μL, MgSO 4 (100mmol / L) 1.2μL, Eva_green 1μL, add sterile deionized H 2 Make up 25 μL of O, mix well, and use sterilized double distilled water as negative control. The reaction program on the fluorescent quantitative PCR instrument is 63°C, 55 seconds, 63°C, 5 seconds, read the fluorescence ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 