Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC

A technology of puc19-atti-400-attc and puc19-attl-400-attc, which is applied in the direction of introducing foreign genetic material using a vector, recombinant DNA technology, etc., can solve the failure of the in vitro activity assay method of bacterial drug resistance integrase, etc. problem, to achieve the effect of easy screening

Inactive Publication Date: 2016-05-25
河套学院
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The in vitro integration activity method of gene therapy tool enzyme phiC31 has been established, and the in vitro activity detection method of human immunodeficiency virus HIV-1 integrase has also been established, but the in vitro activity detection method of bacterial drug resistance integrase has not been successful.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC
  • Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC
  • Construction method of drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] In order to make the objects and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described here are only used to explain the present invention, not to limit the present invention.

[0034] like Figure 1-2 As shown, the construction method of the drug-resistant Escherichia coli integrase integration vector pUC19-attI-400-attC comprises the following steps:

[0035] S1. Using 440DNA as a template, PCR amplification was performed with the following primers to obtain 440bpinsertion;

[0036] F: CGGGATCCAGGGCGAGGAGCTGTTCACC;

[0037] R: ACGCGTCGACGTTGTGGCTGTTGTAGTTG;

[0038] The PCR reaction system is:

[0039] 10×PCRBuffer2.5μL; dNTP(2.5mM)1.6μL; primersF(5P)

[0040] 1 μL; primersR (5P) 1 μL; Taq (5U / μL) 0.125 μL; ddH2O 16.775 μL; DNA 2 μL;

[0041] S2. Using the attI and attC sequences reported by NCBI as templates, d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a drug-resistant Escherichia coli intergrase integration vector pUC19-attI-400-attC. The recombinant containing attI and attC recombinant sites is constructed, a 440bp DNA sequence exists between the attI and attC recombinant sites, the vector is small and only contains 3270bp, the attI and attC sites can be simultaneously cut, the attC site also can be individually cut, and the vector also contains more than 10 multiple cloning sites, so a user can conveniently select suitable restrictive endonuclease to research the action site of intergrase; and the vector has aminobenzyl resistance, is convenient to screen, can be used to carry out in vitro detection of the vector model of the integration activity of the drug-resistant bacterial intergrase, and also can be used to explore the integration mechanism of other bacterial integrons.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for constructing a drug-resistant Escherichia coli integrase integration vector pUC19-attI-400-attC. Background technique [0002] Under the selection pressure of antibiotics, bacterial drug-resistant strains are constantly increasing, and bacteria acquire exogenous drug-resistant genes through horizontal gene transfer is an important way for bacteria to form multi-drug resistance. The bacterial drug resistance mechanism mediated by the integron-gene cassette system has attracted much attention because it can explain the rapid spread of drug resistance genes. Integrons can be located on plasmids, chromosomes, or participate in transfer as a part of transposons. Integrons are composed of three parts: 5'conserved end, 3'conserved end and the variable region between the two. The 5'conserved end is the basic structure of the integron, including the gene encoding integrase...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66
Inventor 贾芳杨江流
Owner 河套学院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com