Xanthine dehydrogenase, and coding gene thereof and application

A coding gene and coding technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems such as no commercial microbial source XDH report, achieve a wide range of pH tolerance and temperature tolerance, reduce costs , the effect of reducing the dosage of enzymes

Active Publication Date: 2016-07-06
TSINGHUA UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, except for a very small number of XDH derived from cattle and chickens that can be obtained commercially, such as the cattle XDH provided by MyBioSource in the United States, there have been no reports of commercialized XDH derived from microorganisms.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xanthine dehydrogenase, and coding gene thereof and application
  • Xanthine dehydrogenase, and coding gene thereof and application
  • Xanthine dehydrogenase, and coding gene thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, the construction of the recombinant plasmid pTrc99A-RcXDHNHis containing the rhodobacter capsularis xanthine dehydrogenase gene

[0045] 1. Extract the genomic DNA of Rhodobacter capsulatus with the preservation number CGMCC1.3366.

[0046] 2. Design and synthesize the following primers

[0047] Upstream primer: 5'-GGC TCATGA TGCATCATCATCACCATCACCATATGGAAATTGCGTTTCTTTCTCAATG-3' (SEQ ID No. 1)

[0048] (The underlined sequence is the recognition site for PagI digestion, and the italic part is the coding sequence of the 6xHistag purification tag introduced for the convenience of purification)

[0049] Downstream primer: 5'-GCC AAGCTT ATCACCCGGTCTGTCCTTCC-3' (SEQ ID No. 2)

[0050] (The underlined sequence is the recognition site for HindIII digestion)

[0051] 3. Using the genomic DNA of rhodobacter capsularis extracted in step 1 as a template, and using the upstream primer and the downstream primer as primers, PCR amplification is carried out to obta...

Embodiment 2

[0055] Embodiment 2, the purification of recombinant xanthine dehydrogenase

[0056] 1. Transform pTrc99A-RcXDHNHis into Escherichia coli DH5α to obtain recombinant bacteria, pick a single colony of recombinant bacteria, inoculate in 5ml LB liquid medium containing 100μg / ml ampicillin, and culture overnight at 37°C and 220r / min. Transfer the overnight cultured bacterial solution to 500ml LB liquid medium containing 100μg / mL ampicillin according to the inoculum size of 1%, and cultivate it at 37°C and 220r / min until the bacterial solution is cultivated to OD 600 0.6, add IPTG inducer with a final concentration of 1mmol / L, and continue to induce culture for 16h under the same conditions.

[0057] 2. Centrifuge the bacterial solution obtained in step 1 at 9000r / min and 4°C, collect the precipitate, and obtain the engineered bacteria induced by expression. After the precipitate is washed once with 50mmol / L phosphate buffer (pH7.5), it is resuspended in 100ml of the same In the bu...

Embodiment 3

[0065] Embodiment 3, the characterization of recombinant xanthine dehydrogenase

[0066] One, the assay method of xanthine dehydrogenase enzymatic activity

[0067] The 2mL reaction system is shown in Table 1.

[0068] The 2mL reaction system composition of table 1 xanthine dehydrogenase activity assay

[0069]

[0070] Mix the remaining reagents in the 2mL reaction system in Table 1 except the aqueous solution of recombinant xanthine dehydrogenase prepared in Example 2 and place it in a 35°C water bath for 5 minutes, then add 100 μL of the recombinant xanthine dehydrogenase prepared in Example 2 An aqueous enzyme solution initiates the reaction. Record the OD within 3-5min of the reaction while reacting at 35°C 295 Absorbance value change, calculate the rate of change of absorbance with time in the initial linear part of the reaction curve (ΔOD 295 / min), the rate of change of absorbance with time (ΔOD 295 / min) reflects the rate at which the recombinant xanthine dehy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a xanthine dehydrogenase, its coding gene and application. The present invention discloses a protein, which is composed of the protein shown in (1) and / or the protein shown in (2): (1) the protein shown in SEQ ID No.4 or the protein shown in SEQ ID No.4 The amino acid sequence shown has undergone substitution and / or deletion and / or addition of one or several amino acid residues and a protein with the same function; (2) the protein shown in SEQ ID No.5 or the protein shown in SEQ ID No.5 A protein whose amino acid sequence has undergone substitution and / or deletion and / or addition of one or several amino acid residues and has the same function. The xanthine dehydrogenase disclosed by the invention is beneficial to the further development of new application fields in combination with other enzymes, and is especially suitable for the needs of commercial applications such as sample detection and industrial application.

Description

technical field [0001] The invention relates to a xanthine dehydrogenase and its encoding gene and application, belonging to the field of biotechnology. Background technique [0002] Xanthineoxidoreductase (Xanthineoxidoreductase, referred to as XOR) is a complex structure of oxidoreductases containing [2Fe-2S] clusters, molybdenum pterin and flavin .17.3.2) and xanthine dehydrogenase (Xanthinedehydrogenase, referred to as XDH, EC1.17.1.4) two different forms of general term. XOR is capable of utilizing various types of electron acceptors, such as molecular oxygen, NAD, methylene blue, benzoquinone, ferricyanide, and nitrate, to catalyze the conversion of a variety of substrates including purines, pteridines, heterocyclic molecules, and aldehydes Oxidation reaction (Li Lishu, Chen Xianhua, Shao Yebo, Liu Xuan, Xu Ping, "Structure, Function and Action of Xanthine Oxidoreductase", Journal of Cell Biology, 2004, 26:381-384). Therefore, XOR, as an important commercial enzyme w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12Q1/32
Inventor邢新会王成华张翀
OwnerTSINGHUA UNIV