Aeromonas sobria specific primer and application thereof in turbot cultivation process
An Aeromonas and specific technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that restrict the healthy development of the turbot breeding industry and the economic losses of farmers, etc. , to achieve the effect of promoting large-scale healthy development, simple detection, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 A kind of Aeromonas temperis specific primer
[0037] (1) Design of specific primers for Aeromonas sobria
[0038] In this example, aiming at the dnaJ gene of the strain Aeromonas sobria (Aeromonas sobria), a pair of specific primers S with strong specificity and high sensitivity to Aeromonas sobria (Aeromonas sobria) were designed by using MEGA6 software , the specific information of the Aeromonas sobria-specific primers is shown in Table 1.
[0039] Table 1
[0040]
[0041] (2) Exploration of optimal PCR reaction conditions for Aeromonas temperii specific primers
[0042] 1. DNA extraction of strains to be tested
[0043] Use the Ezup column's genomic DNA extraction kit (bacteria) to extract the DNA of Aeromonas temperatus (Aeromonassobria) strains, the specific steps are as follows:
[0044] 1.1) Take 1ml of overnight cultured bacterial solution containing the strain Aeromonas sobria (Aeromonas sobria), add it to a 1.5ml centrifuge tube, centrifu...
Embodiment 2
[0075] Embodiment 2 The PCR detection method of Aeromonas temperatus in a kind of turbot breeding process
[0076] Methods as below:
[0077] 1. Extract the total DNA of bacteria in the lesion site of turbot;
[0078] The tissue at the lesion was washed repeatedly with 1ml sterile water, at least three times, then the liquid was collected, and the Ezup column's genomic DNA extraction kit (bacteria) was used to extract the total DNA of the bacteria at the lesion of turbot. The specific steps were as in the above example Step 1 of (2) in 1.
[0079] 2. Using DNA as a template, using the Aeromonas sobria-specific primers described in Example 1, amplified by the PCR method to obtain a PCR product;
[0080] Upstream primer F: GCTGATTTTGGTGATGCGTTCA
[0081] Downstream primer R:TACGTACAGATCCCCAGCCC
[0082]
[0083] PCR reaction conditions: the first stage: 94 ° C for 1 min;
[0084] The second stage: 94°C for 30s, 60°C for 1min, 72°C for 30s; 30 cycles;
[0085] The third ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com