Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Aeromonas sobria specific primer and application thereof in turbot cultivation process

An Aeromonas and specific technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems that restrict the healthy development of the turbot breeding industry and the economic losses of farmers, etc. , to achieve the effect of promoting large-scale healthy development, simple detection, and strong specificity

Inactive Publication Date: 2016-08-24
LIAONING UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the rapid outbreak of bacterial diseases in the turbot breeding process has seriously affected and restricted the healthy development of the turbot farming industry in my country, and brought huge economic losses to the farmers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aeromonas sobria specific primer and application thereof in turbot cultivation process
  • Aeromonas sobria specific primer and application thereof in turbot cultivation process
  • Aeromonas sobria specific primer and application thereof in turbot cultivation process

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 A kind of Aeromonas temperis specific primer

[0037] (1) Design of specific primers for Aeromonas sobria

[0038] In this example, aiming at the dnaJ gene of the strain Aeromonas sobria (Aeromonas sobria), a pair of specific primers S with strong specificity and high sensitivity to Aeromonas sobria (Aeromonas sobria) were designed by using MEGA6 software , the specific information of the Aeromonas sobria-specific primers is shown in Table 1.

[0039] Table 1

[0040]

[0041] (2) Exploration of optimal PCR reaction conditions for Aeromonas temperii specific primers

[0042] 1. DNA extraction of strains to be tested

[0043] Use the Ezup column's genomic DNA extraction kit (bacteria) to extract the DNA of Aeromonas temperatus (Aeromonassobria) strains, the specific steps are as follows:

[0044] 1.1) Take 1ml of overnight cultured bacterial solution containing the strain Aeromonas sobria (Aeromonas sobria), add it to a 1.5ml centrifuge tube, centrifu...

Embodiment 2

[0075] Embodiment 2 The PCR detection method of Aeromonas temperatus in a kind of turbot breeding process

[0076] Methods as below:

[0077] 1. Extract the total DNA of bacteria in the lesion site of turbot;

[0078] The tissue at the lesion was washed repeatedly with 1ml sterile water, at least three times, then the liquid was collected, and the Ezup column's genomic DNA extraction kit (bacteria) was used to extract the total DNA of the bacteria at the lesion of turbot. The specific steps were as in the above example Step 1 of (2) in 1.

[0079] 2. Using DNA as a template, using the Aeromonas sobria-specific primers described in Example 1, amplified by the PCR method to obtain a PCR product;

[0080] Upstream primer F: GCTGATTTTGGTGATGCGTTCA

[0081] Downstream primer R:TACGTACAGATCCCCAGCCC

[0082]

[0083] PCR reaction conditions: the first stage: 94 ° C for 1 min;

[0084] The second stage: 94°C for 30s, 60°C for 1min, 72°C for 30s; 30 cycles;

[0085] The third ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an aeromonas sobria specific primer and application thereof in the turbot cultivation process. The aeromonas sobria specific primer provided by the invention is composed of an upstream primer F: GCTGATTTTGGTGATGCGTTCA and a downstream primer R: TACGTACAGATCCCCAGCCC. The aeromonas sobria specific primer designed by the invention can effectively distinguish aeromonas sobria from various common pathogenic bacterial strains, and shows extremely high specificity and sensitivity. According to a PCR detection method of aeromonas sobria in the turbot cultivation process provided by the invention, the detection for aeromonas sobria in the cultivation process is simpler and more convenient, a necessary theoretical basis and a perfect method system are provided for the detection and analysis of high-incidence pathogenic bacteria in the turbot cultivation process in future, and a foundation is established for promoting large-scale healthy development of the culture industry in China.

Description

technical field [0001] The invention belongs to the field of detection of pathogenic microorganisms, and in particular relates to a PCR detection method for Aeromonas sobria (Aeromonas sobria), a common pathogenic bacterium in the breeding process of turbot. Background technique [0002] Turbot, known as the "Turbofish", has been introduced to my country for 10 years. With its excellent seedlings, advanced innovative models and the trend of industrialized farming, it has gradually become an important fish farming industry that attracts the attention of the country. industry. The development of this brand-new industry has played a great role in stimulating my country's aquatic economy, and has laid a solid theoretical and practical foundation for the vertical development of industrialized fish farming in coastal cities in northern my country. However, with the rapid growth of the breeding scale, the increase of the breeding density, and the deterioration of the water environm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/686C12Q1/689
Inventor 刘宏生顾颖张新刚张力赵健
Owner LIAONING UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com