Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

30 results about "Aeromonas sobria" patented technology

Lauroyl arginine ethyl ester derivative and application thereof as animal antibacterial agent

The invention relates to a novel veterinary antibacterial agent and in particular relates to a lauroyl arginine ethyl ester ion pair compound derivative which is prepared from lauroyl arginine ethyl ester LAE and an organic acid through reactions. As a livestock aquatic animal antibacterial agent, the derivative is capable of preventing and treating duckling riemerella anatipestifer diseases caused by riemerella anatipestifer, is capable of treating peritonitis diseases caused by escherichia coli and staphylococcus aureus, is capable of preventing and treating fish septicemia caused by aeromonas sobria, and has remarkably improved prevention and treatment effects when being compared with a conventional LAE veterinary antibacterial agent. The derivative can be completely degraded in human bodies and animal bodies and is small in toxic and side effect, environment drug resistance bacteria caused by residual antibacterial agents discharged into the environment can be avoided, and small adverse environment influence can be caused while an effective antibacterial effect is achieved.
Owner:EAST CHINA NORMAL UNIV

Preparation method and application of compound microbial substrate modifier with aquatic pathogen antagonistic characteristic

The invention belongs to the technical field of microorganisms and discloses a preparation method and application of a compound microbial substrate modifier with an aquatic pathogen antagonistic characteristic. Two strains namely bacillus subtilis AB-90008-15 and lactobacillus gasseri 88 are provided, and the compound microbial substrate modifier is obtained by strain activation, fermentation culture, centrifugal strain collection and vacuum drying and grinding. The compound microbial substrate modifier has an antagonistic action on aquatic pathogens such as aeromonas hydrophila, aeromonas sobria, aeromonas veronii, aeromonas caviae, Edwardsiella tarda, listonella anguillarum, vibrio parahaemolyticus and vibrio alginolyticus and is capable of degrading carbonaceous organics and nitrogenousorganics in pond sediment, promoting sediment mineralization, reducing contents of total nitrogen, total phosphorus, nitrite, ammonia nitrogen and COD of aquaculture water, promoting virtuous cycle of waternutrients, preventing accumulation of toxic and harmful substances and improving an aquaculture substrate ecological environment.
Owner:江苏省苏微微生物研究有限公司

Pseudomonas strain and application thereof

ActiveCN105349463AThere is no ecological security riskCompliance with Biosafety RegulationsBiocideBacteriaBacteroidesSludge
The invention discloses a pseudomonas strain and application thereof. The strain is pseudomonas protegens IAS03, and is preserved in the China center for type culture collection on November 27th, 2015, and the preservation number is CCTCC NO:M 2015711. The strain is screened from pond bottom sludge and then a backwater body is used, so that ecological safety risks do not exist, and biological safety regulations are conformed. The strain has the specific antimicrobial function on aeromonas hydrophila and aeromonas sobria, has no inhibition effect on other bacteria and has no pathogenicity on fishes. Only one strain can be used for inhibiting aeromonas hydrophila and / or aeromonas sobria. Compared with traditional antibiotic and sterilizing agent prevention measures, the strain has the advantages of being safe, environmentally friendly and efficient. The strain can be developed into a microecological preparation to control aeromonas sobria and aeromonas hydrophila in the breeding environment and prevent hemorrhagic septicemia caused when the fishes are infected with aeromonas sobria and aeromonas hydrophila.
Owner:JINAN UNIVERSITY

Aquaculture creature disease controlling compound vaccine and its preparation method

Disclosed is an aquaculture creature disease controlling compound vaccine which mainly comprises vibrio alginolyticus, bibrio parahemolyticus, vibrio alginolyticus, Aeromonas hydrophila, Aeromonas sobria, Pseudomonas aeruginosa, and Vibrio alginolyticus. The invention also discloses the preparing process for the composite bacterial vaccine.
Owner:DALIAN UNIV

Traditional Chinese medicinal recipe for inhibiting aeromonas sobria

The invention discloses a traditional Chinese medicinal recipe for inhibiting aeromonas sobria. The recipe is characterized by comprising at least one of catechu, galla chinensis, fructus schisandrae chinensis, fructus mume, pericarpium granati, aluminis usti, corydalis bungeana turcz, radix clematidis, radix sanguisorbae, flos caryophyllata, coptis chinensis franch, fructus carpesii, siegesbeckia orientalis L, folium artemisiae argyi, fructus perillae, herba euphorbiae humifusae, rhizoma polygoni cuspidate, radix rhapontici, semen cassiae, spica prunellae, radix isatidis, radix angelicae dahuricae, herba centipedae, white paeony root, fried myrrha, cortex magnoliae officinalis, radix asteris, fructus cnidii, wild chrysanthemum, radix et rhizoma rhei, fructus forsythiae, hedyotis diffusa, fructus rubi, anemone chinensis, semen arecae, tetradium ruticarpum, gentiana scabra bunge, chaenomeles speciosa, raw rhizoma atractylodis, folium isatidis, houttuynia cordata, cortex moutan radicis and sapium sebiferum, wherein a recipe which is formed by mixing the catechu, the galla chinensis, the schisandrae chinensis and the fructus mume according to the mass ratio of 2:4:1:2 has an optimal antibacterial effect. The recipe has the advantages of naturality, no toxity and residues, no tolerance and low price.
Owner:NINGBO UNIV

Soil conditioner and preparation method

The invention relates to the technical field of agricultural planting and discloses a soil conditioner and a preparation method. The soil conditioner is prepared from, in parts by weight, compound bacteria, an aid and 100-150 parts of selenium-rich organic fertilizer, wherein the compound bacteria comprise, in parts by weight, 0.1-0.5 parts of sheep tripe hyphae, 0.1-0.2 parts of aeromonas sobria, 0.2-0.5 parts of bacillus subtilis, 0.2-0.5 parts of bacillus thuringiensis, 0.2-0.5 parts of paenibacillus polymyxa and 0.1-0.2 parts of verticillium; the aid is prepared from, in parts by weight, 10-30 parts of quick lime and 10-20 parts of ground phosphate rock. The soil conditioner is applied to planting of grain crops in clay land and can effectively increase the selenium conversion rate of grain plants; the preparation method of the soil conditioner adopts a simple process and is low in cost.
Owner:INST OF AGRI PROD QUALITY SAFETY & STANDARD JIANGXI ACAD OF AGRI SCI

Detection kit for distinguishing three aquatic source aeromonas composite groups

The invention discloses a detection kit for distinguishing three aquatic source aeromonas composite groups, and aims at providing a detection kit which is capable of simultaneously screening three common aquatic source aeromonas composite groups, namely an aeromonas hydrophila composite group, an aeromonas sobria composite group and an aeromonas caviae composite group, and is low in cost and high in detection accuracy rate. According to the technical scheme, the detection kit for distinguishing the three aquatic source aeromonas composite groups comprises the following identification materials: 1) a reagent A, sterile water, 2) an identification bottle 1, salt-free alkaline peptone water, 3) an identification bottle 2, RS culture medium containing ampicillin, 4) an identification bottle 3, tryptone soya culture medium, 5) an identification bottle 4, arabinose culture medium, 6) an identification bottle 5, esculoside culture medium, 7) an identification bottle 26, glucose gas medium, and 8) an identification bottle 7, an oxidase strip. The detection kit belongs to the technical field of detection.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Multiplex-PCR primer and application thereof in cultivation process of turbots

The invention relates to a multiplex-PCR primer and an application thereof in the cultivation process of turbots. The multiplex-PCR primer consists of an aeromonas hydrophila specific primer H, an aeromonas sobria specific primer S and an aeromonas schubetii specific primer Ss. A method for rapidly identifying pathogenic bacteria in the cultivation process of turbots comprises the following steps: extracting total DNA of bacteria of a focus of turbots; by taking the extracted DNA as a template, performing PCR amplification by using the multiplex-PCR primer; and judging according to a sepharose gel imaging result of a PCR amplification primer. Through one time of PCR reaction, three common pathogenic bacteria in the cultivation process of turbots can be detected simultaneously, and very good specificity and sensitivity can be achieved. In the cultivation process of turbots, once the risk that the turbots are infected by the three aeromonas exists, the etiology can be rapidly identified, and cultivation households can be prevented from heavy loss.
Owner:LIAONING UNIVERSITY

Process for the preparation of cell beads BOD sensor useful for instant BOD estimation

InactiveUS20030036186A1Least chemical damageLeast physical damageBacteriaMicrobiological testing/measurementBacteroidesSerratia
Immobilized cell beads incorporating formulated microbial consortium comprising a synergistic mixture of the following bacterial strains namely, Enterobacter sakazaki, Pseudomonas aeruginosa and Aeromonas sobria selected from the following isolated bacterial strains namely, Yersinia enterocolitica, Aeromonas sobria, Klebsiella pneumoniae, Serratia liquefaciens, Enterobacter sakazaki, Citrobacter amalonaticus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Enterobacter cloaca, Acinetobacter calcoaceticus are prepared, the formulated microbial consortium is immobilized in an appropriate immobilizing agent resulting in the formation of beads and the beads are used for instant BOD estimation using an electronic device and the formulated cell beads are reusable and are capable of assimilating most of the organic matter present in varied industrial effluents.
Owner:COUNCIL OF SCI & IND RES

LAMP detection primer combination of aeromonas sobria and kit

The invention discloses an LAMP detection primer combination of aeromonas sobria and a kit. The LAMP detection primer combination of aeromonas sobria comprises a pair of outer primers AS-F3 and AS-B3, a pair of inner primers AS-FIP and AS-BIP and a pair of loop primers AS-LF and AS-LB. the kit comprises the detection primer combination, BstDNA polymerase, an LAMP reaction solution, confining liquid mineral oil, a positive control and a negative control. The invention also discloses a method for detecting aeromonas sobria by the utilization of the above LAMP detection kit of aeromonas sobria. The kit provided by the invention is simple and rapid to operate, is suitable for field test, has high specificity, high detection sensitivity and high and reliable accuracy, and has a wide application prospect. The detection sensitivity of the kit can reach 320fg / mL.
Owner:广州百博生物科技有限公司

Freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine and industrialized preparation method thereof

The invention relates to a bivalent inactivated vaccine, and specifically, relates to a freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine and an industrialized preparation method thereof. The freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine comprises inactivated antigen compositions of aeromonas hydrophila culture inactivated liquid and aeromonas sobria culture inactivated liquid. The invention also provides the industrialized preparation method of the freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine. The industrialized preparation method is characterized by comprising the following steps of mixing uniformly the aeromonas hydrophila culture inactivated liquid and the aeromonas sobria culture inactivated liquid according to a ratio of 1: 1, and carrying out aseptic loading to obtain freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine finished products. The freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine overcomes the defect that a monovalent vaccine has an effect only on a pathogen. The freshwater fish aeromonas hydrophila-aeromonas sobria bivalent inactivated vaccine has the effect of resisting two pathogens simultaneously by being applied once, and can be conveniently applied through immersion, injection or feeding after mixing with forage.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Preparation method and use method of loach aeromonas sobria vaccine

The invention discloses a preparation method of a loach aeromonas sobria vaccine, which is characterized by comprising the following step: preparing a water aqua type loach aeromonas sobria vaccine using radix astragali as an adjuvant by using loach pathogenic aeromonas sobria LD081008A-1 as immunogen and a radix astragali lixivium as the adjuvant, wherein the concentration of the pathogenic aeromonas sobria as the immunogen in the vaccine is 2.7*108 cells / mL, and the concentration of the radix astragali lixivium is 1 g / mL. The invention further discloses a use method of the loach aeromonas sobria vaccine. By using the loach aeromonas sobria vaccine prepared by the method, the capability of the resistance of loaches to aeromonas sobria infection can be obviously improved; the immune protecting capability of the loaches to the pathogenic aeromonas sobria is enhanced; the survival rate of cultivating loaches is improved; the yield of cultivating the loaches is increased; the export obstacle caused by drug residue is avoided; the economic benefit in the cultivation production of the loaches is improved; and the problem that diseases caused by the aeromonas sobria easily appearing in the current cultivation production process of the loaches is solved foundationally.
Owner:HUAIHAI INST OF TECH

Aeromonas sobria specific primer and application thereof in turbot cultivation process

The invention relates to an aeromonas sobria specific primer and application thereof in the turbot cultivation process. The aeromonas sobria specific primer provided by the invention is composed of an upstream primer F: GCTGATTTTGGTGATGCGTTCA and a downstream primer R: TACGTACAGATCCCCAGCCC. The aeromonas sobria specific primer designed by the invention can effectively distinguish aeromonas sobria from various common pathogenic bacterial strains, and shows extremely high specificity and sensitivity. According to a PCR detection method of aeromonas sobria in the turbot cultivation process provided by the invention, the detection for aeromonas sobria in the cultivation process is simpler and more convenient, a necessary theoretical basis and a perfect method system are provided for the detection and analysis of high-incidence pathogenic bacteria in the turbot cultivation process in future, and a foundation is established for promoting large-scale healthy development of the culture industry in China.
Owner:LIAONING UNIVERSITY

Kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR)

The invention provides a kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR), and comprises an upstream primer of which the DNA sequence is 5'-TGGCCTTGACATGTCTGGAATCCT-3', a downstream primer of which the DNA sequence is 5'-ACCATTACGTGCTGGCAACAAAGG-3', and a TaqMan probe of which the DNA sequence is 5'-(FAM)-AATCAGAACACAGGTGCTGCATGGCT-(TAMRA)-3', wherein each reagent is packaged in a sealed mode. The kit is designed according to 16SrDNA in the aeromonas hydrophila and aeromonas sobria; and compared with the prior art, the kit has the advantages that: only one pair of universal primers is adopted to simultaneously detect the two pathogenic bacteria, and the real-time and quick effect is achieved in the aspects of emergency pre-warning and burst disease treatment.
Owner:ZHEJIANG OCEAN UNIV +1

Method and detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria

The invention discloses a method and a detection kit for detecting aeromonas sobria scaleless fish pathogenic bacteria. The kit comprises a primer B, which has sequences represented by a sequence SEQ ID No.1 and a sequence SEQ ID No.2, for amplifying a gene from aeromonas sobria. The method of the invention can be used for quickly and accurately detecting if pathogenic bacteria grow in the bodies of scaleless fish or culturing water, so the specific fish disease prevention and control can be realized.
Owner:TONGWEI

Compound bacterial agent containing bacillus methylotrophicus and application thereof in preparation of drugs for aquatic animal diseases

The invention belongs to the field of development and application of microorganisms, and in particular, relates to a compound bacterial agent containing bacillus methylotrophicus and an application thereof in preparation of drugs for aquatic animal diseases. The compound bacterial agent comprises bacillus methylotrophicus YFi-1, bacillus licheniformis and bacillus subtilis. The compound bacterialagent provided by the invention has no pathogenicity to aquatic animals, and has good inhibitory effect on aquatic pathogenic bacteria including aeromonas veronii, aeromonas hydrophila, aeromonas sobria, edwardsiella tarda, pseudomonas fragi and streptococcus agalactiae. The compound bacterial agent has a good control effect on bacterial diseases of aquatic animals, and has a good application prospect.
Owner:YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI

Use of chitobiose in preparation of bacteriostatic fishery drugs or bacteriostatic fish feeds

The invention discloses use of chitobiose in preparation of bacteriostatic fishery drugs or bacteriostatic fish feeds, the inhibited bacteria are vibrio anguillarum, aeromonas hydrophila, aeromonas sobria, aeromonas punctata and flexibacrer marilimys. The chitobiose has obvious antibacterial activity, is a natural antibacterial substance free of toxic and side effects, and can significantly improve the disease resistance ability of cultured fishes by using as a fishery drug to add into basal feeds.
Owner:HUAIHAI INST OF TECH

Aeromonas sobria AP06 strain with phosphor gathering effect and application thereof

ActiveCN105733997AHigh efficiency of phosphorus accumulationBacteriaWater contaminantsPhosphorSewage
The invention provides an aeromonas sobria AP06 strain.The strain is preserved in the China Center for Type Culture Collection on March 7th, 2016, the address is Wuhan university of Wuchang district in Wuhan city of Hubei province, the preservation number is CCTCC NO: M2016093, the nucleotide sequence of the strain is as shown in SEQ ID NO.1, and 755 basic groups are included.Observation is performed in an isolation medium, and the bacterial colony of the AP06 strain is milk white, smooth in surface, thick and not transparent and is in the shape of a short rod when being observed under a microscope.The aeromonas sobria AP06 strain can be used for treating sewage containing phosphor, the pH valve is 7, temperature is 30 DEG C, a phosphor source is KH2PO4, and under the condition that the inoculation amount is 7%, the phosphor gathering efficiency of the strain is larger than 86%.
Owner:宜昌巴楚蔬菜科技开发有限公司

Preparation method and use method of loach aeromonas sobria vaccine

The invention discloses a preparation method of a loach aeromonas sobria vaccine, which is characterized by comprising the following step: preparing a water aqua type loach aeromonas sobria vaccine using radix astragali as an adjuvant by using loach pathogenic aeromonas sobria LD081008A-1 as immunogen and a radix astragali lixivium as the adjuvant, wherein the concentration of the pathogenic aeromonas sobria as the immunogen in the vaccine is 2.7*108 cells / mL, and the concentration of the radix astragali lixivium is 1 g / mL. The invention further discloses a use method of the loach aeromonas sobria vaccine. By using the loach aeromonas sobria vaccine prepared by the method, the capability of the resistance of loaches to aeromonas sobria infection can be obviously improved; the immune protecting capability of the loaches to the pathogenic aeromonas sobria is enhanced; the survival rate of cultivating loaches is improved; the yield of cultivating the loaches is increased; the export obstacle caused by drug residue is avoided; the economic benefit in the cultivation production of the loaches is improved; and the problem that diseases caused by the aeromonas sobria easily appearing in the current cultivation production process of the loaches is solved foundationally.
Owner:HUAIHAI INST OF TECH

A novel bacteriostatic compound, a preparing method thereof and applications of the bacteriostatic compound in aquatic products

The invention relates to a novel bacteriostatic compound named as Butein-0908, a preparing method thereof and applications of the bacteriostatic compound in aquatic products. When the mass percentage is 0.06%, the bacteriostatic compound can inhibit staphylococcus aureus, bacillus subtilis, salmonella bacillus, bacillus proteus and escherichia coli, has strong inhibiting functions for common pathogenic bacteria of the aquatic products, has obvious and rapid sterilization functions for aeromonas hydrophila, aeromonas sobria and non-O1 group vibrio cholerae, and can kill all bacteria in 12 h. Accordingly, the bacteriostatic compound is wide in antibacterial spectrum, few in side and toxic effects and high in bacteriostatic activity, is especially suitable for the common pathogenic bacteria of the aquatic products, and can be widely used as an economical and environmental friendly bacteriostatic agent for aquatic product bacteriostasis.
Owner:ZHEJIANG OCEAN UNIV

Kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR)

The invention provides a kit for detecting aeromonas hydrophila and aeromonas sobria through fluorescence quantitive polymerase chain reaction (FQ-PCR), and comprises an upstream primer of which the DNA sequence is 5'-TGGCCTTGACATGTCTGGAATCCT-3', a downstream primer of which the DNA sequence is 5'-ACCATTACGTGCTGGCAACAAAGG-3', and a TaqMan probe of which the DNA sequence is 5'-(FAM)-AATCAGAACACAGGTGCTGCATGGCT-(TAMRA)-3', wherein each reagent is packaged in a sealed mode. The kit is designed according to 16SrDNA in the aeromonas hydrophila and aeromonas sobria; and compared with the prior art, the kit has the advantages that: only one pair of universal primers is adopted to simultaneously detect the two pathogenic bacteria, and the real-time and quick effect is achieved in the aspects of emergency pre-warning and burst disease treatment.
Owner:ZHEJIANG OCEAN UNIV +1

Efficient lytic phage vB-AsoP-yong of Aeromonas sobria and application of efficient lytic phage vB-AsoP-yong

The invention discloses efficient lytic phage vB-AsoP-yong of Aeromonas sobria and an application of the efficient lytic phage vB-AsoP-yong, and relates to the biological treatment of Aeromonas sobriapollution and infection. The vB-AsoP-yong is preserved in the China General Microbiological Culture Collection Center, and the preservation number of the vB-AsoP-yong is CGMCC No.17097. The vB-AsoP-yong is the first phage obtained by taking a pathogenic Aeromonas sobria LY-23 strain as a target for separation, and can specifically lyse Aeromonas sobria, the optimum MOI is 0.001, the incubation period is about 50 min, the lytic period is 50 min-150 min, and the burst amount is 7665 PFU / Cell; the vB-AsoP-yong has relatively good tolerance to factors such as temperature, pH and chloroform; and the vB-AsoP-yong has the protective effect on animals.
Owner:NINGBO UNIV

A kind of Pseudomonas bacterial strain and its application

ActiveCN105349463BThere is no ecological security riskCompliance with Biosafety RegulationsBiocideBacteriaBacteroidesSludge
The invention discloses a pseudomonas strain and application thereof. The strain is pseudomonas protegens IAS03, and is preserved in the China center for type culture collection on November 27th, 2015, and the preservation number is CCTCC NO:M 2015711. The strain is screened from pond bottom sludge and then a backwater body is used, so that ecological safety risks do not exist, and biological safety regulations are conformed. The strain has the specific antimicrobial function on aeromonas hydrophila and aeromonas sobria, has no inhibition effect on other bacteria and has no pathogenicity on fishes. Only one strain can be used for inhibiting aeromonas hydrophila and / or aeromonas sobria. Compared with traditional antibiotic and sterilizing agent prevention measures, the strain has the advantages of being safe, environmentally friendly and efficient. The strain can be developed into a microecological preparation to control aeromonas sobria and aeromonas hydrophila in the breeding environment and prevent hemorrhagic septicemia caused when the fishes are infected with aeromonas sobria and aeromonas hydrophila.
Owner:JINAN UNIVERSITY

Pelteobagrus fulvidraco mixed bacterium inactivated vaccine

The invention discloses a pelteobagrus fulvidraco mixed bacterium inactivated vaccine. The vaccine comprises the following inactivated antigen compositions: aeromonas sobria inactivated liquid, pseudomonas putida inactivated liquid and plesiomonas shigelloides inactivated liquid in a ratio of 1:1:1, wherein the concentration of the aeromonas sobria inactivated solution is 25 x 10<8> CFU / mL, the concentration of the pseudomonas putida inactivated solution is 25 x 10<8> CFU / mL, and the concentration of the plesiomonas shigelloides inactivated solution is 25 x 10<8> CFU / mL. Antigen components ofthe mixed bacterium inactivated vaccine can generate comprehensive humoral immunity induction on pelteobagrus fulvidraco; and by using the mixed bacterium inactivated vaccine, the immunization frequency can be reduced, the immunization cost is saved, the damage to the pelteobagrus fulvidraco caused by repeated inoculation is reduced, and the application value in actual production is relatively high.
Owner:GUANGXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products