Multiplex-PCR primer and application thereof in cultivation process of turbots
A turbot, multiple technology, applied in the directions of microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of economic losses of farmers, restrict the healthy development of turbot breeding industry, etc., and achieve simple and sensitive detection. High, the effect of recovering a lot of losses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1 A kind of multiplex PCR primer
[0061] (1) Design of multiplex PCR primers
[0062] The present embodiment aims at the dnaJ gene of bacterial species Aeromonas hydrophila, Aeromonas sobria Aeromonassobria and Aeromonas schubert Aeromonas Aeromonasschubertii, utilizes the MEGA6 software to design the Aeromonas hydrophila-specific primer H, Aeromonas sobria-specific primer S and Schuber with strong specificity and high sensitivity Aeromonas specific primer Sc, the specific information of the multiple specific primers is shown in Table 1.
[0063] Table 1
[0064]
[0065] (2) Exploration of optimal PCR reaction conditions for multiplex PCR primers
[0066] 1. DNA extraction of strains to be tested
[0067] Use the Ezup Column's Genomic DNA Extraction Kit (Bacteria) to extract the DNA of Aeromonas hydrophila (Aeromonas hydrophila), Aeromonas temperate (Aeromonassobria) and Aeromonas Schubert (Aeromonasschubertii), the specific steps as follows:
[00...
Embodiment 2
[0095] Embodiment 2 A kind of multiple PCR detection method of pathogenic bacteria in turbot cultivation process
[0096] Model: A turbot model infected with Aeromonas hydrophila was made.
[0097] Methods as below:
[0098] 1. Extract the total DNA of bacteria in the lesion site of turbot;
[0099] The tissue at the lesion was washed repeatedly with 1ml sterile water, at least three times, then the liquid was collected, and the Ezup column's genomic DNA extraction kit (bacteria) was used to extract the total DNA of the bacteria at the lesion of turbot. The specific steps were as in the above example Step 1 of (2) in 1.
[0100] 2. Using the extracted DNA as a template, the multiple PCR primers described in Example 1 were used to amplify by PCR method to obtain
[0101] to the PCR product;
[0102] The sequence of the upstream primer F1 is: CGACGTGTTTGGCGATATTTTTG
[0103] The sequence of the downstream primer R1 is: GTCTTGGTCTTCTGGTAGCGA
[0104] The sequence of the ups...
Embodiment 3
[0115] Embodiment 3 Multiplex PCR detection method of pathogenic bacteria in a turbot culture process
[0116] Model: Making a turbot model infected with Aeromonas temperatus.
[0117] Method is with embodiment 2.
[0118] Results: For the detection of 26 turbots infected with Aeromonas temperii, the agarose gel only showed a 486bp band.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com