Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiplex-PCR primer and application thereof in cultivation process of turbots

A turbot, multiple technology, applied in the directions of microorganism-based methods, microorganism determination/inspection, microorganisms, etc., can solve the problems of economic losses of farmers, restrict the healthy development of turbot breeding industry, etc., and achieve simple and sensitive detection. High, the effect of recovering a lot of losses

Active Publication Date: 2016-07-06
LIAONING UNIVERSITY
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the rapid outbreak of bacterial diseases in the turbot breeding process has seriously affected and restricted the healthy development of the turbot farming industry in my country, and brought huge economic losses to the farmers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiplex-PCR primer and application thereof in cultivation process of turbots
  • Multiplex-PCR primer and application thereof in cultivation process of turbots
  • Multiplex-PCR primer and application thereof in cultivation process of turbots

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1 A kind of multiplex PCR primer

[0061] (1) Design of multiplex PCR primers

[0062] The present embodiment aims at the dnaJ gene of bacterial species Aeromonas hydrophila, Aeromonas sobria Aeromonassobria and Aeromonas schubert Aeromonas Aeromonasschubertii, utilizes the MEGA6 software to design the Aeromonas hydrophila-specific primer H, Aeromonas sobria-specific primer S and Schuber with strong specificity and high sensitivity Aeromonas specific primer Sc, the specific information of the multiple specific primers is shown in Table 1.

[0063] Table 1

[0064]

[0065] (2) Exploration of optimal PCR reaction conditions for multiplex PCR primers

[0066] 1. DNA extraction of strains to be tested

[0067] Use the Ezup Column's Genomic DNA Extraction Kit (Bacteria) to extract the DNA of Aeromonas hydrophila (Aeromonas hydrophila), Aeromonas temperate (Aeromonassobria) and Aeromonas Schubert (Aeromonasschubertii), the specific steps as follows:

[00...

Embodiment 2

[0095] Embodiment 2 A kind of multiple PCR detection method of pathogenic bacteria in turbot cultivation process

[0096] Model: A turbot model infected with Aeromonas hydrophila was made.

[0097] Methods as below:

[0098] 1. Extract the total DNA of bacteria in the lesion site of turbot;

[0099] The tissue at the lesion was washed repeatedly with 1ml sterile water, at least three times, then the liquid was collected, and the Ezup column's genomic DNA extraction kit (bacteria) was used to extract the total DNA of the bacteria at the lesion of turbot. The specific steps were as in the above example Step 1 of (2) in 1.

[0100] 2. Using the extracted DNA as a template, the multiple PCR primers described in Example 1 were used to amplify by PCR method to obtain

[0101] to the PCR product;

[0102] The sequence of the upstream primer F1 is: CGACGTGTTTGGCGATATTTTTG

[0103] The sequence of the downstream primer R1 is: GTCTTGGTCTTCTGGTAGCGA

[0104] The sequence of the ups...

Embodiment 3

[0115] Embodiment 3 Multiplex PCR detection method of pathogenic bacteria in a turbot culture process

[0116] Model: Making a turbot model infected with Aeromonas temperatus.

[0117] Method is with embodiment 2.

[0118] Results: For the detection of 26 turbots infected with Aeromonas temperii, the agarose gel only showed a 486bp band.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a multiplex-PCR primer and an application thereof in the cultivation process of turbots. The multiplex-PCR primer consists of an aeromonas hydrophila specific primer H, an aeromonas sobria specific primer S and an aeromonas schubetii specific primer Ss. A method for rapidly identifying pathogenic bacteria in the cultivation process of turbots comprises the following steps: extracting total DNA of bacteria of a focus of turbots; by taking the extracted DNA as a template, performing PCR amplification by using the multiplex-PCR primer; and judging according to a sepharose gel imaging result of a PCR amplification primer. Through one time of PCR reaction, three common pathogenic bacteria in the cultivation process of turbots can be detected simultaneously, and very good specificity and sensitivity can be achieved. In the cultivation process of turbots, once the risk that the turbots are infected by the three aeromonas exists, the etiology can be rapidly identified, and cultivation households can be prevented from heavy loss.

Description

technical field [0001] The invention belongs to the field of detection of pathogenic microorganisms, in particular to three common pathogenic bacteria in the breeding process of turbot: Aeromonas hydrophila (Aeromonas hydrophila), Aeromonas temperate (Aeromonassobria) and Aeromonas Schubert Multiplex PCR detection method for Aeromonasschubertii. Background technique [0002] Turbot, known as the "Turbofish", has been introduced to my country for 10 years. With its excellent seedlings, advanced innovative models and the trend of industrialized farming, it has gradually become an important fish farming industry that attracts the attention of the country. industry. The development of this brand-new industry has played a great role in stimulating my country's aquatic economy, and has laid a solid theoretical and practical foundation for the vertical development of industrialized fish farming in coastal cities in northern my country. However, with the rapid growth of the breedin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/01
CPCC12Q1/686C12Q1/689C12Q2600/16C12Q2537/143C12Q2565/125
Inventor 刘宏生顾颖张新刚张力赵健
Owner LIAONING UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com