Primer, probe, kit and method for fluorogenic quantitative PCR detection on pig delta coronavirus
A coronavirus and fluorescence quantitative technology, applied in the field of animal virology and molecular biology, can solve the problems such as difficult to distinguish, and achieve the effect of fast monitoring, high specificity and sensitivity, and simple operation
Inactive Publication Date: 2016-09-07
WENS FOODSTUFF GRP CO LTD
View PDF2 Cites 3 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
The researchers also found that whether it is natural infection or artificial infection, the symptoms and pathological changes of piglet diarrhea caused by PDCoV are very similar to those caused by PEDV and TGEV, and it is difficult to distinguish them clinically.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0027] Embodiment 1 A kind of fluorescent quantitative PCR detects the primer, probe and method of porcine deltacoronavirus
[0028] 1, Primer design
[0029] According to the information provided by the porcine delta coronavirus genome sequence registered by NCBI, accession numbers: KJ601780, KJ601778, KU051649, KU051641, KR131621, KJ601777, after comparative analysis, primers and probes for fluorescent quantitative PCR were designed, respectively F, R , P:
[0030] Upstream primer F: GAGCTGACACTTCTATTAAA (SEQ ID NO: 1);
[0031] Downstream primer R: TGGAGTTAACAGATTGAGA (SEQ ID NO: 2);
[0032] Probe P: TTCCACGCTCCTGAGGTCTTC (SEQ ID NO: 3)
[0033] Among them, the 5' and 3' ends of P are marked with FAM and BHQ1, respectively.
[0034] Using the above primers and probes for fluorescent quantitative PCR amplification can detect porcine deltacoronavirus through the amplification curve, eliminating the steps of sequencing and saving time and cost.
[0035] 2. Detection me...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a primer, a probe, a kit and a method for fluorogenic quantitative PCR detection on pig delta coronavirus. The primer is as shown in SEQ ID NO:1 and SEQ ID NO:2. The probe is as shown in SEQ ID NO:3. The method comprises the following steps: by taking RNA of a sample to be detected as a template, performing reverse transcription so as to obtain cDNA, further performing fluorogenic quantitative PCR amplification reaction, collecting fluorescence signals, and drawing curves. The primer and the probe for detecting the pig delta coronavirus, which are disclosed by the invention, are very high in specificity and sensitivity, the pig delta coronavirus can be detected, various clinical samples can be detected, the infection situation of pig delta coronavirus in clinical treatment can be rapidly and conveniently monitored, and simplicity and practicability of operation can be achieved.
Description
technical field [0001] The invention belongs to the technical field of animal virology and molecular biology. More specifically, the invention relates to a primer, a probe, a kit and a method for detecting porcine delta coronavirus by fluorescent quantitative PCR. Background technique [0002] Porcine deltacoronavirus (Porcine Deltacoronavirus, PDCoV) is a newly discovered coronavirus that can cause diarrhea in pigs, especially newborn piglets. One of the important reasons. Porcine deltacoronavirus belongs to Nidoviridae, Coronaviridae, member of deltacoronavirus genus, and is a single-stranded positive-strand RNA virus with envelope. [0003] The virus was first detected in Hong Kong in 2012 by Woo et al. ,Wang,M.,Zheng,B.J.,Chan,K.H.,Yuen,K.Y.,2012.Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the genesource of alphacoronavirus and betacoronavirus and avian deltacoronavirus and avian deltacoronaviru...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/701C12Q2545/113C12Q2563/107Y02A50/30
Inventor 王东东田小艳潘永飞李春梅宋延华
Owner WENS FOODSTUFF GRP CO LTD