Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same
A biomolecular and molecular technology, applied in biochemical equipment and methods, bioinformatics, microbial measurement/inspection, etc., can solve the problems of unable to produce and analyze experimental plans, quality control, unable to propose reference materials and quality control, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0062]The preparation method of the external marker and the biochip of the present invention comprises: a first step of determining the biomolecules not included in the biological sample to be analyzed, and using the determined exogenous biomolecules to prepare the external marker; the second step , to determine the ligands that bind to biomolecules and external markers; the third step, to determine the ligands for the analysis of biological significance; The needles were synthesized, and the above-mentioned capture probes were immobilized on the substrate.
[0063] The preparation method of the external marker of the present invention is as follows. In the case of examining a biological sample using a biochip, examination of a transcriptome, a proteome, or the like is a typical example. In the case of transcriptome analysis, internal markers such as glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Glyceraldehyde 3-phosphate dehydrogenase) or actin messenger ribonucleic acid ...
Embodiment 1
[0215] Embodiment 1. Preparation of random base sequence single-stranded nucleic acid
[0216] Using a single-stranded deoxyribose nucleic acid oligonucleotide having the following random base sequence, double-stranded deoxyribonucleic acid was prepared by polymerase chain reaction (PCR, Polymerase Chain Reaction), and then prepared by in vitro transcription Single-stranded ribonucleic acid library (random single-stranded nucleic acid).
[0217] 5'- GGGAGAGCGGAAGCGTGCTGGGCC N40 CATAACCCAGAGGTCGA TGGATCCCCCC -3' (wherein, the underlined base sequence is a fixed part of the nucleic acid library, and N40 represents a sequence part in which bases such as A, G, T and C exist in a random manner.)
[0218] The FW primer used in the polymerase chain reaction can base-bond to the 5' end of the underlined bases in the above-mentioned base arrangement, and contains a promoter base sequence for ribonucleic acid polymerase of bacteriophage T7.
[0219] The RE primer used in the pol...
Embodiment 2
[0223] Example 2. Preparation of biomolecules bound to single-stranded nucleic acid bound to human serum proteins
[0224] 2-1. Ensuring biomolecule-single-stranded nucleic acid complex
[0225] 2-1-1. Cleaning method
[0226] In the present invention, the biological sample composed of two or more biomolecules is human serum protein. 10 of the random single-stranded nucleic acid synthesized in Example 1 15 The concentration solution of the base sequence / L is in the selection buffer (50mM TrisCl (pH7.4), 5mM KCl, 100mM NaCl, 1mM MgCl) at a concentration of 200pmol / L 2 , 0.1% NaN 3 ), heated at 80° C. for 10 minutes, and then left in ice for 10 minutes. Add 5 times the yeast transfer ribonucleic acid (tRNA, Transfer Ribonucleic Acid) (yeast tRNA, Life Technologies company) and 0.2% bovine serum albumin (BSA, bovine serum albumin, Merck company) of the used single-stranded nucleic acid to prepare the reaction solution.
[0227] 10 µl of a serum biological sample containing ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 