Unlock instant, AI-driven research and patent intelligence for your innovation.

Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same

A biomolecular and molecular technology, applied in biochemical equipment and methods, bioinformatics, microbial measurement/inspection, etc., can solve the problems of unable to produce and analyze experimental plans, quality control, unable to propose reference materials and quality control, etc.

Active Publication Date: 2016-09-21
金圣千
View PDF14 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0020] Although the present inventors have proposed the reverse-exponential enrichment ligand system evolution technology (reverse-SELEX) (refer to Korean Patent Registration No. 10-0670799) for the production of experimental protocols for proteomes, aptamer-based nucleic acid chips (refer to Korean Patent Registration No. 10-0464225) and the biological significance analysis technology based on aptamer nucleic acid chips (refer to Korean Patent Registration No. 10-0923048), etc. , it is impossible to propose a suitable reference substance and quality control (quality control) scheme, so there is a problem that it may not be possible to perform appropriate quality control on the production and analysis of the experimental program, and the present invention proposes to solve this phenomenon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same
  • Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same
  • Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0062]The preparation method of the external marker and the biochip of the present invention comprises: a first step of determining the biomolecules not included in the biological sample to be analyzed, and using the determined exogenous biomolecules to prepare the external marker; the second step , to determine the ligands that bind to biomolecules and external markers; the third step, to determine the ligands for the analysis of biological significance; The needles were synthesized, and the above-mentioned capture probes were immobilized on the substrate.

[0063] The preparation method of the external marker of the present invention is as follows. In the case of examining a biological sample using a biochip, examination of a transcriptome, a proteome, or the like is a typical example. In the case of transcriptome analysis, internal markers such as glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Glyceraldehyde 3-phosphate dehydrogenase) or actin messenger ribonucleic acid ...

Embodiment 1

[0215] Embodiment 1. Preparation of random base sequence single-stranded nucleic acid

[0216] Using a single-stranded deoxyribose nucleic acid oligonucleotide having the following random base sequence, double-stranded deoxyribonucleic acid was prepared by polymerase chain reaction (PCR, Polymerase Chain Reaction), and then prepared by in vitro transcription Single-stranded ribonucleic acid library (random single-stranded nucleic acid).

[0217] 5'- GGGAGAGCGGAAGCGTGCTGGGCC N40 CATAACCCAGAGGTCGA TGGATCCCCCC -3' (wherein, the underlined base sequence is a fixed part of the nucleic acid library, and N40 represents a sequence part in which bases such as A, G, T and C exist in a random manner.)

[0218] The FW primer used in the polymerase chain reaction can base-bond to the 5' end of the underlined bases in the above-mentioned base arrangement, and contains a promoter base sequence for ribonucleic acid polymerase of bacteriophage T7.

[0219] The RE primer used in the pol...

Embodiment 2

[0223] Example 2. Preparation of biomolecules bound to single-stranded nucleic acid bound to human serum proteins

[0224] 2-1. Ensuring biomolecule-single-stranded nucleic acid complex

[0225] 2-1-1. Cleaning method

[0226] In the present invention, the biological sample composed of two or more biomolecules is human serum protein. 10 of the random single-stranded nucleic acid synthesized in Example 1 15 The concentration solution of the base sequence / L is in the selection buffer (50mM TrisCl (pH7.4), 5mM KCl, 100mM NaCl, 1mM MgCl) at a concentration of 200pmol / L 2 , 0.1% NaN 3 ), heated at 80° C. for 10 minutes, and then left in ice for 10 minutes. Add 5 times the yeast transfer ribonucleic acid (tRNA, Transfer Ribonucleic Acid) (yeast tRNA, Life Technologies company) and 0.2% bovine serum albumin (BSA, bovine serum albumin, Merck company) of the used single-stranded nucleic acid to prepare the reaction solution.

[0227] 10 µl of a serum biological sample containing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to: a reference substance and a nucleic acid chip for generating binding information on biomolecules and analysis single-stranded nucleic acids in a biosample composed of biomolecules; a preparation method therefor; and a method for analyzing biomolecules by using the same, and the reference substance and the nucleic acid chip can be used for analyzing the biological meaning of the biomolecules. In addition, the present invention relates to: a method for preparing an external marker and a biochip for generating the binding information of biomolecules and ligands; and a method for analyzing biomolecules by using the same. The external marker and the biochip of the present invention can be used in the field of analyzing the biological meaning of the biomolecules.

Description

technical field [0001] The present invention relates to reference substances and nucleic acid chips for predicting the biological significance of biomolecules in biological samples composed of biomolecules, their preparation methods, biomolecular analysis methods and devices using them, and related to methods for generating biomolecules. An external marker for binding information between molecules and ligands, a method for preparing a biochip, and a method for analyzing biomolecules using them. Background technique [0002] Techniques for producing experimental protocols for many biomolecules (proteins and carbohydrates) that make up biological samples have been widely developed with the development of physics, biochemistry and bioinformatics, but due to the use and maintenance costs of existing methods or equipment, Ease of use, accuracy, sensitivity, inspection time and automation of the process, etc., have a high necessity for effective new methods and devices. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G06F19/10C12Q1/68C12N15/11G01N33/50G16B25/20G16B25/30G16B40/20
CPCC12Q1/6837C12Q1/68C12N15/11G01N33/50G16B99/00G16B25/20G16B25/30G16B40/20C12Q2525/117C12Q2565/519
Inventor 金圣千
Owner 金圣千