Marker for generating binding information between biomolecules and nucleic acid, method for producing same, biomolecule analysis method and device using the marker
An analysis method and technology of biological samples, applied in the direction of biochemical equipment and methods, bioinformatics, microbial measurement/inspection, etc., can solve quality control, unable to produce and analyze experimental plans, unable to propose reference materials and quality control And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0062]The preparation method of the external marker and the biochip of the present invention comprises: a first step of determining the biomolecules not included in the biological sample to be analyzed, and using the determined exogenous biomolecules to prepare the external marker; the second step , to determine the ligands that bind to biomolecules and external markers; the third step, to determine the ligands for the analysis of biological significance; The needles were synthesized, and the above-mentioned capture probes were immobilized on the substrate.
[0063] The preparation method of the external marker of the present invention is as follows. In the case of examining a biological sample using a biochip, examination of a transcriptome, a proteome, or the like is a typical example. In the case of transcriptome analysis, internal markers such as glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Glyceraldehyde 3-phosphate dehydrogenase) or actin messenger ribonucleic acid ...
Embodiment 1
[0215] Embodiment 1. Preparation of random base sequence single-stranded nucleic acid
[0216] Using a single-stranded deoxyribose nucleic acid oligonucleotide having the following random base sequence, double-stranded deoxyribonucleic acid was prepared by polymerase chain reaction (PCR, Polymerase Chain Reaction), and then prepared by in vitro transcription Single-stranded ribonucleic acid library (random single-stranded nucleic acid).
[0217] 5'- GGGAGAGCGGAAGCGTGCTGGGCC( SEQ ID NO.1) N40 CATAACC CAGAGGTCGATGGATCCCCCC -3' (SEQ ID NO.2) (Wherein, the underlined base arrangement is a fixed part of the nucleic acid library, and N40 represents the sequence part where bases such as A, G, T and C exist in a random manner.)
[0218] The FW primer used in the polymerase chain reaction can base-bond to the 5' end of the underlined bases in the above-mentioned base arrangement, and contains a promoter base sequence for ribonucleic acid polymerase of bacteriophage T7.
[0219] ...
Embodiment 2
[0223] Example 2. Preparation of biomolecules bound to single-stranded nucleic acid bound to human serum proteins
[0224] 2-1. Ensuring biomolecule-single-stranded nucleic acid complex
[0225] 2-1-1. Cleaning method
[0226] In the present invention, the biological sample composed of two or more biomolecules is human serum protein. 10 of the random single-stranded nucleic acid synthesized in Example 1 15 The concentration solution of the base sequence / L is in the selection buffer (50mM TrisCl (pH7.4), 5mM KCl, 100mM NaCl, 1mM MgCl) at a concentration of 200pmol / L 2 , 0.1% NaN 3 ), heated at 80° C. for 10 minutes, and then left in ice for 10 minutes. Add 5 times the yeast transfer ribonucleic acid (tRNA, Transfer Ribonucleic Acid) (yeast tRNA, Life Technologies company) and 0.2% bovine serum albumin (BSA, bovine serum albumin, Merck company) of the used single-stranded nucleic acid to prepare the reaction solution.
[0227] 10 µl of a serum biological sample containing ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


