A lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus
A technology of lentiviral vector and expression vector, applied in the field of efficiently mediating Gα gene overexpression lentiviral vector and lentivirus and its construction, can solve the problems of low success rate and low transfection efficiency, and achieve the effect of promoting stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Construction of Gα gene overexpression lentiviral vector.
[0043] 1. Artificially synthesized Gα gene, the DNA sequence of which is shown in SEQ ID NO.1.
[0044] 2. Using PrimeSTAR high-fidelity enzyme, using the artificially synthesized Gα gene as a template, perform PCR amplification with the primers shown in Table 1:
[0045] Table 1
[0046] Primer name
Primer sequence (5'-3')
SEQ ID NO.
Gα-F
agattctagagctagcaccaccatggatggcccgctcgctg
2
Gα-R
agatccttgcggccgctcagaagagcccacagtc
3
[0047] The PCR reaction system and conditions are shown in Table 2:
[0048] Table 2
[0049] Reagent
volume
template
1μL
Upstream primer (10μM)
1μL
Downstream primer (10μM)
1μL
Prime STAR Max (2x)
10μL
wxya 2 o
7μL
total capacity
20 μL
[0050] The PCR program is shown in Table 3:
[0051] table 3
[0052]
[0053] 3. Agarose gel elect...
Embodiment 2
[0069] Example 2: Packaging of Gα lentiviruses
[0070] 1. Replace the HEK293 cells with a confluence of more than 80% with antibiotic-free medium DMEM+10% (v / v) FBS, 37°C, 5% (v / v) CO 2 Incubator for 2 hours.
[0071] 2. Mix the packaging plasmid mixture (pLP / VSVG+pLP1+pLP2, 3 μg each) and 4 μg Gα gene overexpression lentiviral vector in 400 μL 0.9% (w / v) saline, and add 50 μL transfection reagent Fitran, room temperature After standing and incubating for 20 minutes, slowly and evenly drop it into the culture dish containing HEK293 cells in step 1, and shake it properly; record it as the start time of transfection.
[0072] 3. After 4-6 hours of transfection, prepare to change the medium. After discarding the old medium, absorb an appropriate amount of PBS to gently rinse the cells for 1-2 times, and replace with DMEM medium containing 2% (v / v) FBS.
[0073] 4. Collect the supernatant 72 hours after transfection, centrifuge the collected supernatant at 3000rpm at 4°C for 10...
Embodiment 3
[0076] Example 3: Cell Transfection
[0077] 1. Cultivate HEK293 cells in a 6-well cell culture plate, and transfect the cells after the cells are completely attached to the confluence of 40%-50%; before transfection, replace the cells in each well with 500 μL of fresh DMEM for complete culture Base, and 1 μL of polybrene (polybrene) was added to each well, and placed in an incubator for 1 h.
[0078] 2. Add 5 μL of the Gα lentivirus solution obtained in Example 2 to the two wells of the above-mentioned 6-well cell culture plate, and add 10 μL of the empty lentivirus solution to one well of the cells (the empty lentivirus solution and the Gα lentivirus solution The only difference is that it does not contain the Gα gene, and the rest of the preparation methods are the same), and the other well is used as a blank cell control. 2 , 95% relative humidity incubator.
[0079] 3. After 6 hours of transfection, suck away the medium in the well, and wash it twice with PBS; replace i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
