A lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus

A technology of lentiviral vector and expression vector, applied in the field of efficiently mediating Gα gene overexpression lentiviral vector and lentivirus and its construction, can solve the problems of low success rate and low transfection efficiency, and achieve the effect of promoting stable expression

Inactive Publication Date: 2016-12-21
CHINA TOBACCO YUNNAN IND
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing method uses the plasmid vector integrated with the Gα gene to transfect host cells through liposomes, but the transfection efficiency of liposome-transfected plasmid vectors is low, and it is necessary to construct a stable co-expression of T1R2 and T1R3 and Gα genes have a lower success rate in cell lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus
  • A lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus
  • A lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Construction of Gα gene overexpression lentiviral vector.

[0043] 1. Artificially synthesized Gα gene, the DNA sequence of which is shown in SEQ ID NO.1.

[0044] 2. Using PrimeSTAR high-fidelity enzyme, using the artificially synthesized Gα gene as a template, perform PCR amplification with the primers shown in Table 1:

[0045] Table 1

[0046] Primer name

Primer sequence (5'-3')

SEQ ID NO.

Gα-F

agattctagagctagcaccaccatggatggcccgctcgctg

2

Gα-R

agatccttgcggccgctcagaagagcccacagtc

3

[0047] The PCR reaction system and conditions are shown in Table 2:

[0048] Table 2

[0049] Reagent

volume

template

1μL

Upstream primer (10μM)

1μL

Downstream primer (10μM)

1μL

Prime STAR Max (2x)

10μL

wxya 2 o

7μL

total capacity

20 μL

[0050] The PCR program is shown in Table 3:

[0051] table 3

[0052]

[0053] 3. Agarose gel elect...

Embodiment 2

[0069] Example 2: Packaging of Gα lentiviruses

[0070] 1. Replace the HEK293 cells with a confluence of more than 80% with antibiotic-free medium DMEM+10% (v / v) FBS, 37°C, 5% (v / v) CO 2 Incubator for 2 hours.

[0071] 2. Mix the packaging plasmid mixture (pLP / VSVG+pLP1+pLP2, 3 μg each) and 4 μg Gα gene overexpression lentiviral vector in 400 μL 0.9% (w / v) saline, and add 50 μL transfection reagent Fitran, room temperature After standing and incubating for 20 minutes, slowly and evenly drop it into the culture dish containing HEK293 cells in step 1, and shake it properly; record it as the start time of transfection.

[0072] 3. After 4-6 hours of transfection, prepare to change the medium. After discarding the old medium, absorb an appropriate amount of PBS to gently rinse the cells for 1-2 times, and replace with DMEM medium containing 2% (v / v) FBS.

[0073] 4. Collect the supernatant 72 hours after transfection, centrifuge the collected supernatant at 3000rpm at 4°C for 10...

Embodiment 3

[0076] Example 3: Cell Transfection

[0077] 1. Cultivate HEK293 cells in a 6-well cell culture plate, and transfect the cells after the cells are completely attached to the confluence of 40%-50%; before transfection, replace the cells in each well with 500 μL of fresh DMEM for complete culture Base, and 1 μL of polybrene (polybrene) was added to each well, and placed in an incubator for 1 h.

[0078] 2. Add 5 μL of the Gα lentivirus solution obtained in Example 2 to the two wells of the above-mentioned 6-well cell culture plate, and add 10 μL of the empty lentivirus solution to one well of the cells (the empty lentivirus solution and the Gα lentivirus solution The only difference is that it does not contain the Gα gene, and the rest of the preparation methods are the same), and the other well is used as a blank cell control. 2 , 95% relative humidity incubator.

[0079] 3. After 6 hours of transfection, suck away the medium in the well, and wash it twice with PBS; replace i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lentiviral vector efficiently mediating Galpha gene overexpression, a lentivirus and constructing methods of the lentiviral vector and the lentivirus, and belongs to the technical field of molecular biology. Through a gene recombination technique, construction is performed based on a pCDH-CMV-MCS-EF1-copGFP lentiviral expression vector, and a Galpha gene is combined to obtain the Galpha-gene-overexpression lentiviral vector that is pCDH-CMV-MCS-EF1-copGFP-Galpha. Lentiviral packaging plasmids which are pLP / VSVG, pLP1 and pLP2 are adopted to package the Galpha-gene-overexpression lentiviral vector that is the pCDH-CMV-MCS-EF1-copGFP-Galpha, and a Galpha lentivirus is obtained through transfecting an HEK293 cell. The Galpha-gene-overexpression lentiviral vector is high in host cell transfection efficiency and capable of specifically, continuously and efficiently promoting stable expression of the Galpha gene in host cells.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a lentiviral vector for efficiently mediating Gα gene overexpression, a lentivirus and a construction method thereof. Background technique [0002] Taste function studies have shown that sweetness is mainly mediated by the G protein-coupled receptors (GPCRs) family of taste cells, that is, taste receptor family 1 members (T1Rs). Among them, T1R2 and T1R3 are sweet taste receptors, they function in the form of T1R2+T1R3 heterodimer, and jointly recognize sweet taste. After the sweet taste receptor binds to the ligand, the downstream G protein is activated, its α subunit is separated from the β and γ subunits, and the Gα subunit enters the cytoplasm to activate downstream effectors, eventually leading to an increase in the intracellular calcium ion concentration. Therefore, by constructing a cell line co-expressing T1R2, T1R3 and Gα genes, the calcium flux de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N15/66C12N7/01
CPCC12N15/86C07K14/4722C12N7/00C12N2740/15021C12N2740/15043
Inventor夭建华朱洲海李雪梅缪明明米其利管莹高茜刘欣
OwnerCHINA TOBACCO YUNNAN IND