Unlock instant, AI-driven research and patent intelligence for your innovation.
A closely linked snp marker for soybean dwarf traits and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technique for soybeans and dwarf stems, applied in the field of genetic engineering, can solve the problems of identification limited by time and growth period, low breeding efficiency, high breeding cost, etc., and achieve the effect of reducing field test materials and labor costs, and reducing field breeding area
Inactive Publication Date: 2020-01-17
JILIN ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0005] The existing identification technology or method of soybean dwarf traits is to identify whether it is a dwarf material by naked eyes after the soybean flowering stage is late, and the plant height is stable; the identification is limited by time and growth period
In addition, because the plant height is affected by environmental conditions such as planting density, mechanical damage, and field precipitation, it is impossible to accurately judge whether it is tall or short by only investigating one plant, and accurate group surveys are required; in dwarf stem breeding, because dwarf stem is a recessive gene The controlled ones account for only 1 / 2 [1-(1 / 2)r] of the segregation population. If selection is carried out in the early generation of breeding, there will be less dwarf material in the breeding population. Therefore, the breeding scale should be relatively large. In order to be able to screen out excellent dwarf breeding materials, the breeding cost is high and the breeding efficiency is low
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0032] Example 1 Obtaining of SNP markers closely linked to soybean dwarf traits
[0033] 1. Genetic mapping of dwarf traits
[0034] (1) 377 F obtained by crossing "Jimidou 1" and "Bus 9112" 2 Individual plant DNA and its F 2:3 Plant height expression for genetic mapping of soybean dwarf traits.
[0035] (2) Survey F 2:3 The plant height of each line of the genetic population, under the conditions of 55 ridge spacing, 15 cm plant spacing, and 2 seeds, the plant height greater than 70 is defined as non-dwarf stem, and the height less than or equal to 70 is defined as dwarf stem. Use X 2 Quiz Analysis F 2:3 Is the height separation of strains consistent with 3:1 ( figure 1 ), if it meets 3:1, the dwarf trait is controlled by a single gene, and it is regarded as a quality trait.
[0036] (3) CTAB method extracts its F 2 For DNA of a single plant, dissolve the DNA in sterile water, the concentration should be greater than 50ng / ul, OD 260 / 280 =1.8-2.1; 0.1% agarose gel wa...
Embodiment 2
[0042] Example 2 Development of SNP markers linked to dwarf stem traits
[0043] (1)针对其中均匀分布的12个标签(Marker1098514,Marker1168024,Marker1143721,Marker1110430,Marker1120990,Marker1086045,Marker1118571,Marker11080703,Marker1093726,Marker1102167,Marker1094495,Marker1061721)中的12个SNP位点(44412186,44546232,44595030, 44622364, 44779426, 44815533, 44902890, 4,5000827, 45361938, 45423153, 45494716), using KASP technology (LGC Biological Company) to design and synthesize 11 SNP primers, the specific primer pairs are as follows:
[0044] GM19_44412186 primer pair sequence:
[0045] F1: TACTTTATTTCGTTAGGTCT
[0046] F2: TACTTTATTTCGTTAGGTCC
[0047] R: TTACCATAACATACAAAAGAC
[0048] GM19_44546232 primer pair sequence:
[0049] F1:ATGGAAACAATTTAAATGA
[0050] F2: ATGGAAACAATTTAAATGT
[0051] R: ATTGTGACTAATTAATCGTA
[0052] GM19_44595030 primer pair sequence:
[0053] F1:TTTAACTCATTAAGGTTTAT
[0054] F2:TTTAACTCATTAAGGTTTAG
[0055] R: CATTAGCAAACAAAAAAGGA
[0056] GM19_44622364 prim...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a closely linked SNP marker for soybean dwarf traits, including: GM19_45000827 and GM19_45361938, wherein GM19_45000827 is C or A at position 45000827 of chromosome 19 of soybean genome v1.0; GM19_45361938 is soybean genome v1 The base at position 44902890 on chromosome 19 of .0 is G or A, and the application and method of this marker for screening soybean materials with dwarf traits are also described. The present invention detects the soybean genotype through the KASP SNP marker technology, and the dwarf soybean can be identified according to the genotype, thereby accelerating the process of soybean dwarf strain breeding. At the same time, these two SNP markers are also the dwarf genecloning and dwarf mechanism Research lays the groundwork.
Description
technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a closely linked SNP marker for soybean dwarf traits and an application thereof. Background technique [0002] The application of the dwarf trait in crops has realized the first green revolution and is the first milestone in high-yield breeding. Since soybean dwarf trait was applied to breeding in 1967, soybean high-yield records have been continuously created worldwide (Cooper, 1981, Cooper, 1991). Therefore, dwarf trait has become an important research content of soybean breeding. However, in soybean breeding, although the height of the plant is easy to identify with the naked eye, it is seriously affected by factors such as water, fertilizer, planting density and growth period, especially when selecting a single plant in the early generation of breeding, the identification of the dwarf trait is not convenient and accurate. . [0003] With the developm...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More