Method for efficiently hydrolyzing soybean isoflavone glycosides

A technology of hydrolysis reaction and glucosidase, applied in the direction of hydrolytic enzymes, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problems of cumbersome immobilization process, expensive immobilization carrier, unfavorable large-scale use, etc., to achieve The effect of many times of recycling

Active Publication Date: 2017-03-15
UNIV OF SCI & TECH OF CHINA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after 15 times of repeated use, its activity is only 50%, and its immobilization carrier is expensive and the immobilization process is cumbersome, which is not conducive to large-scale industrial use.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently hydrolyzing soybean isoflavone glycosides
  • Method for efficiently hydrolyzing soybean isoflavone glycosides
  • Method for efficiently hydrolyzing soybean isoflavone glycosides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1 Fusion expression of CBM3 and β-glucosidase gene

[0070] 1. Construction of fusion gene expression vector

[0071] Using the pUCBM plasmid as a template (Wan et al.2011) using Primer STAR HS DNA polymerase (Dalian Bao Biology), using Xba I-CBM3-F, Xba I-CBM3-R (SEQ ID NO: 1, 2) as primers The CBM3 gene will be amplified by PCR and digested with Xba I (Thermo Fisher Scientific). The plasmid pPICZaA / bgl1 containing the BGL1 gene was digested with Xba I (Thermo Fisher Scientific) and ligated with CBM3 using T4 ligase to obtain the fusion expression plasmid pPICZαA / bgl1-cbm3.

[0072] The sequences of primers XbaI-CBM3-F and XbaI-CBM3-R are as follows:

[0073] SEQ ID NO: 1: AGTTCTAGACGGTTCTGGATCTGGTTCTGG

[0074] SEQ ID NO: 2: CGTTCTAGAATGGTTCCTTACCCCAAACC

[0075] The specific operation is as follows:

[0076] ①PCR amplification system of CBM3

[0077]

[0078] PCR program

[0079]

[0080] ② Xba I digestion of CBM3

[0081]

[0082] Enzyme ...

Embodiment 2

[0117] Embodiment 2 Immobilization of recombinant glucosidase and the influence of temperature and organic solvent on immobilized enzyme

[0118] 1) Immobilization of recombinant glucosidase and determination of its kinetic constants

[0119] 1. Add glucosidases with total enzyme activities of 3.5U / ml, 4.0U / ml, 4.8U / ml, 5.7U / ml, and 6.2U / ml respectively into 2mg phosphoric acid-swellable amorphous cellulose. Combine at 25°C for 30 min, centrifuge at 12000 g for 5 min, separate the supernatant and wash the precipitate twice with 50 mM citric acid-phosphate buffer (pH 5.0), and dilute to 1.5 mL.

[0120] 2. Measure the enzyme activity in the supernatant of the above-mentioned recovery, according to the Langmuir equation

[0121]

[0122] Wherein Ea is the glucosidase (U / ml) of adsorption; W max is the maximum adsorption capacity of β-glucosidase (U / g); E f is the unbound β-glucosidase (U / ml). The maximum immobilization ability of phosphoric acid swollen amorphous cellulos...

Embodiment 3

[0133] Example 3 Research on Hydrolysis of Soybean Isoflavones by Immobilized Recombinant Enzyme

[0134] 1) Extraction and hydrolysis of soybean isoflavones

[0135] 1. Dissolve 5 g of coarse soybean isoflavone powder (Xi'an Ruilin Biotechnology Co., Ltd.) in 20 mL of 80% ethanol solution in a 50 mL beaker.

[0136] 2. The above mixture was ultrasonically dissolved in a 130W ultrasonic instrument for 30min.

[0137] 3. Centrifuge at 5000 g for 10 min to collect the supernatant.

[0138] 4. Filter the supernatant with a 0.45 μm filter membrane to obtain soybean isoflavones extract (main components: genistin, daidzein, daidzein, genistein, daidzein, glycitein).

[0139] 5. Add 167 μl of the above extract into 333 μl of a reaction system containing 0.1 U of immobilized enzyme, hydrolyze it in a water bath at 50°C for 75 minutes, and then take the reaction solution for HPLC analysis. The test results show that the immobilized enzyme can convert genistin, daidzein, The daidzein...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for efficiently hydrolyzing soybean isoflavone glycosides. The method specifically includes that cellulose-binding domain genes and beta-glucoside enzyme genes are subjected to fusion expression in pichia pastoris by using a gene engineering method; an obtained protein-infused cellulose-binding domain is combined with cellulose through hydrophobic effect to realize immobilization of glucosaccharase. Compared with other immobilization methods, the method has the advantages that pre-purification of enzyme is not needed, assistance in immobilization by other reagents is not needed, time and material cost needed for immobilization is greatly reduced, the enzyme is easy to recycle, industrial mass utilization is favored, and the immobilized beta-glucoside enzyme is quite good in stability and good in hydrolysis capability on the soybean isofalvone glycosides.

Description

[0001] Technical field: [0002] The present invention relates to the field of biotechnology, more specifically to the fields of recombinant expression of protein, high-efficiency immobilization and efficient hydrolysis of soybean isoflavone glycosides, etc., and specifically relates to a method capable of efficiently and quickly immobilizing β-glucosidase, and the ability to use Cyclic use of immobilized enzymes to hydrolyze high-efficiency soybean isoflavone glycosides, and a method for continuously hydrolyzing soybean isoflavone glycosides has also been established. Background technique [0003] Soy isoflavones are estrogen analogs, which have estrogen-like effects and are active ingredients in soybeans. Soybean isoflavones were discovered by an American scholar in the production of soybean germ products in 1986. In 1990, the American Cancer Institute (ACI) of the United States invited relevant experts to conduct research on the anti-cancer effects of soy isoflavones based...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N11/12C12P17/06C12M1/40
CPCC07K2319/00C12M21/18C12M29/00C12M41/22C12N9/2445C12N11/12C12P17/06C12Y302/01021
Inventor洪泂胡圣霖王冬梅
OwnerUNIV OF SCI & TECH OF CHINA