Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of microsatellite marker primer and method for identifying the inbred family of the white shrimp

A microsatellite marker, white shrimp technology, applied in the field of molecular biology, can solve problems such as genetic variation and genetic pollution

Active Publication Date: 2020-03-10
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The salient features of inbred experimental animals are their gene homozygosity and genetic stability. However, in the process of breeding, conservation and reproduction, there is the possibility of genetic variation or genetic contamination. , timed genetic testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of microsatellite marker primer and method for identifying the inbred family of the white shrimp
  • A kind of microsatellite marker primer and method for identifying the inbred family of the white shrimp
  • A kind of microsatellite marker primer and method for identifying the inbred family of the white shrimp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Material

[0035] Research object White shrimp inbred family group F 7 , F 8 , F 9 The first generation is a family of ridgetail white shrimp cultivated by the research group of Li Jian of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences using a fully artificial indoor cultivation. The wild group of white prawns were collected from the sea area of ​​Jiangsu, F 1 The generation group is the offspring of the wild group, and 30 tails are randomly sampled from each group.

[0036] Primer

[0037] In this experiment, 2 pairs of microsatellite markers were screened to detect and identify the white shrimp family. The primers for amplifying microsatellite loci ES034 and ES096 were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and their sequences are:

[0038] ES034

[0039] Forward primer: 5'ACTTCATCCACAAAGCAGAGGT 3',

[0040] Reverse primer: 5'GAAGAAGAGGAAGGTGGGGC3'.

[0041] ES096

[0042] Forward primer: 5'GCAATTTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microsatellite marker primer and method for authenticating an inbred family of palaemon carinicauda, and belongs to the field of molecular biology. Microsatellite marker names are ES034 and ES096. The invention further provides a method for authenticating the inbred family of the palaemon carinicauda by using the primer. According to the microsatellite marker primer and the method, the genetic relationship among individuals in a palaemon carinicauda group is authenticated by using two pairs of the microsatellite primers to judge the inbreeding level among the individuals in the group; when all the individuals have monomorphism segments at 146bp and 263bp, the authenticated group meets the requirement of inbred cultivation. The method supplies a basis for judgment of an inbred line.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a method for using microsatellite markers to identify inbred families of the white shrimp. Background technique [0002] The ridge tail white shrimp belongs to the long arm shrimp family and the white shrimp genus, commonly known as white shrimp, small white shrimp and winter jasmine. It is mainly distributed in the shallow sea and low-salt waters along the coast of mainland China and the west coast of the Korean Peninsula, with the largest output in the Yellow and Bohai Seas. It is an important small and medium-sized economic shrimp in my country. White prawns have the advantages of wide environmental adaptability, miscellaneous food habits, short breeding cycle, and strong disease resistance, which greatly reduces the difficulty of artificial indoor breeding of white prawns. At the same time, adult white prawns are small and transparent in color and easy to Experim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156
Inventor 李健刘萍王佳佳张天时
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More