A kind of microsatellite marker primer and method for identifying the inbred family of the white shrimp
A microsatellite marker, white shrimp technology, applied in the field of molecular biology, can solve problems such as genetic variation and genetic pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Material
[0035] Research object White shrimp inbred family group F 7 , F 8 , F 9 The first generation is a family of ridgetail white shrimp cultivated by the research group of Li Jian of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences using a fully artificial indoor cultivation. The wild group of white prawns were collected from the sea area of Jiangsu, F 1 The generation group is the offspring of the wild group, and 30 tails are randomly sampled from each group.
[0036] Primer
[0037] In this experiment, 2 pairs of microsatellite markers were screened to detect and identify the white shrimp family. The primers for amplifying microsatellite loci ES034 and ES096 were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., and their sequences are:
[0038] ES034
[0039] Forward primer: 5'ACTTCATCCACAAAGCAGAGGT 3',
[0040] Reverse primer: 5'GAAGAAGAGGAAGGTGGGGC3'.
[0041] ES096
[0042] Forward primer: 5'GCAATTTG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



