Universal detection method for high-throughput next-generation sequencing of animal-derived components in biological products
A technology of animal-derived ingredients and biological products, applied in the field of bioengineering, to achieve the effect of eliminating technical barriers to trade, eliminating counterfeiting and adulteration, and saving manpower and material resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Design of general-purpose animal-derived component-specific amplification primers
[0040] By designing multiple sets of primers, the applicant found that the universal detection effect of the high-throughput next-generation sequencing of animal-derived components in biological products is the best by using the general-type animal-derived component-specific amplification primers of the present invention.
[0041] (1) The sequence of the general-purpose animal-derived component-specific amplification primer of the present invention is as follows:
[0042] NGS-382-F TAAGACGAGAAGACCCTRTGGA (SEQ ID NO: 1)
[0043] NGS-382bp-R CGGTCTGAACTCAGATCACGTA (SEQ ID NO: 2)
[0044] (2) The reaction system and reaction program of PCR are shown in Table 3 and Table 4
[0045] Table 3 PCR reaction system
[0046] Element Volume (μl) 2X Taq Master mix 25 Forward primer (10μM) 1 Direction primer (10μM) 1 DNA template (20ng / μl) 1 ddH2O ...
Embodiment 2
[0049] Example 2 High-throughput next-generation sequencing of animal-derived components in biological products, the specific operations are as follows figure 1 shown.
[0050](1) Mix the specific DNAs of the 13 animal samples in Example 1 in equal proportions (as shown in Table 5, each animal sample is mixed in a standard ratio of 7.69%);
[0051] (2) Utilize the general-purpose primer pair of embodiment 1 and the reaction system and reaction program of PCR to carry out ordinary PCR amplification, obtain the amplification product, construct the PCR product library;
[0052] (3) High-throughput sequencing of PCR products was performed using Illumina Miseq 2*300PE mode. The 2*300PE mode of IlluminaMiseq has the characteristics of high throughput and high quality. By connecting the reads at both ends of the pair-end, a high-quality sequencing sequence of about 500bp can be obtained, and the total score covers the length of the amplified fragment of 382bp;
[0053] (4) Perform ...
Embodiment 3
[0059] Example 3 Verifies the applicability of the general-purpose method for high-throughput next-generation sequencing
[0060] In order to verify the applicability of the general-purpose method of next-generation sequencing (that is, whether it is applicable to other next-generation sequencing platforms), the applicant used the same sample and analysis comparison method on Thermo Fisher's Ion Torrent semiconductor sequencing platform verification performed. details as follows:
[0061] (1) The sample preparation method to be tested is the same as the method in Example 2
[0062] Using the same sample as in Example 2, mixed in equal proportions (as shown in Table 6, each animal sample was mixed with a standard ratio of 7.69%);
[0063] (2) Preparation of sequencing library
[0064] Prepared according to the general method of the Ion Torrent semiconductor sequencing platform.
[0065] (3) The sequencing method was performed according to the requirements of the Ion Torrent...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



