Unlock instant, AI-driven research and patent intelligence for your innovation.

Universal detection method for high-throughput next-generation sequencing of animal-derived components in biological products

A technology of animal-derived ingredients and biological products, applied in the field of bioengineering, to achieve the effect of eliminating technical barriers to trade, eliminating counterfeiting and adulteration, and saving manpower and material resources

Active Publication Date: 2021-01-15
PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the deficiency that the existing biological monitoring technology cannot comprehensively identify uncertain animal-derived components, the purpose of the present invention is to provide a general-purpose detection method for high-throughput next-generation sequencing of animal-derived components in biological products, which is based on Qualcomm Quantitative sequencing technology and DNA barcode analysis technology for the detection of general animal-derived components, including general primer pairs, databases, analysis methods, kits and practical application strategies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Universal detection method for high-throughput next-generation sequencing of animal-derived components in biological products
  • Universal detection method for high-throughput next-generation sequencing of animal-derived components in biological products
  • Universal detection method for high-throughput next-generation sequencing of animal-derived components in biological products

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Design of general-purpose animal-derived component-specific amplification primers

[0040] By designing multiple sets of primers, the applicant found that the universal detection effect of the high-throughput next-generation sequencing of animal-derived components in biological products is the best by using the general-type animal-derived component-specific amplification primers of the present invention.

[0041] (1) The sequence of the general-purpose animal-derived component-specific amplification primer of the present invention is as follows:

[0042] NGS-382-F TAAGACGAGAAGACCCTRTGGA (SEQ ID NO: 1)

[0043] NGS-382bp-R CGGTCTGAACTCAGATCACGTA (SEQ ID NO: 2)

[0044] (2) The reaction system and reaction program of PCR are shown in Table 3 and Table 4

[0045] Table 3 PCR reaction system

[0046] Element Volume (μl) 2X Taq Master mix 25 Forward primer (10μM) 1 Direction primer (10μM) 1 DNA template (20ng / μl) 1 ddH2O ...

Embodiment 2

[0049] Example 2 High-throughput next-generation sequencing of animal-derived components in biological products, the specific operations are as follows figure 1 shown.

[0050](1) Mix the specific DNAs of the 13 animal samples in Example 1 in equal proportions (as shown in Table 5, each animal sample is mixed in a standard ratio of 7.69%);

[0051] (2) Utilize the general-purpose primer pair of embodiment 1 and the reaction system and reaction program of PCR to carry out ordinary PCR amplification, obtain the amplification product, construct the PCR product library;

[0052] (3) High-throughput sequencing of PCR products was performed using Illumina Miseq 2*300PE mode. The 2*300PE mode of IlluminaMiseq has the characteristics of high throughput and high quality. By connecting the reads at both ends of the pair-end, a high-quality sequencing sequence of about 500bp can be obtained, and the total score covers the length of the amplified fragment of 382bp;

[0053] (4) Perform ...

Embodiment 3

[0059] Example 3 Verifies the applicability of the general-purpose method for high-throughput next-generation sequencing

[0060] In order to verify the applicability of the general-purpose method of next-generation sequencing (that is, whether it is applicable to other next-generation sequencing platforms), the applicant used the same sample and analysis comparison method on Thermo Fisher's Ion Torrent semiconductor sequencing platform verification performed. details as follows:

[0061] (1) The sample preparation method to be tested is the same as the method in Example 2

[0062] Using the same sample as in Example 2, mixed in equal proportions (as shown in Table 6, each animal sample was mixed with a standard ratio of 7.69%);

[0063] (2) Preparation of sequencing library

[0064] Prepared according to the general method of the Ion Torrent semiconductor sequencing platform.

[0065] (3) The sequencing method was performed according to the requirements of the Ion Torrent...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a universal detection method for high-throughput second-generation sequencing of animal-derived ingredients in a biological product. The universal detection method comprises the following steps: step 1, taking DNA of a to-be-tested sample as a template and performing PCR amplification by utilizing a universal primer pair, wherein an amplified fragment is about 400 bp; step 2, creating a base for an amplification product; step 3, sequencing by utilizing a second-generation sequencing platform; step 4, performing data analysis comparison to confirm species, wherein sequences of the universal primer pair are shown in SEQ ID NO:1 and SEQ ID NO:2. The universal detection method for high-throughput second-generation sequencing of the animal-derived ingredients in the biological product, disclosed by the invention, has the benefits that unknown animal-derived ingredients in food, cosmetics and feed can be quickly identified, full coverage and seamless biological monitoring in the true sense are achieved, the adulterated behavior of an animal-derived product is eliminated from the source, and a technical support is provided for a detection mechanism.

Description

technical field [0001] The invention belongs to the field of bioengineering, in particular, it relates to a general-purpose detection method for high-throughput next-generation sequencing of animal-derived components in biological products, and is a general-purpose species-specific DNA analysis technology based on second-generation sequencing technology , including general-purpose primer pairs, databases, analysis methods, kits and practical application methods. Background technique [0002] Adulteration of animal-derived products is an important issue related to human food safety and the healthy development of animal husbandry. In fact, feed and food safety concerns not only human health, but also the survival of related enterprises, economic development, social stability, and even public confidence in the government. On the one hand, due to the similar physical form of animal tissues, leather, blood, etc. from different species sources and the influence of industrial proc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q2531/113C12Q2535/122C12Q2563/185
Inventor 蔡一村何宇平潘良文
Owner PLANTS & ANIMALS & FOOD TESTING QUARANTINE TECH CENT SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU