A method and special-purpose primers used for detecting aspirin and nitroglycerin accurate administration

A technology of nitroglycerin and aspirin, which is applied in the direction of biochemical equipment and methods, microbe measurement/inspection, etc., to achieve high application value, suitable for popularization and application, and high specificity

Active Publication Date: 2017-07-14
李爱娟
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology has not been applied to the precise drug gene detection of aspirin resistance and nitroglycerin resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method and special-purpose primers used for detecting aspirin and nitroglycerin accurate administration
  • A method and special-purpose primers used for detecting aspirin and nitroglycerin accurate administration
  • A method and special-purpose primers used for detecting aspirin and nitroglycerin accurate administration

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1, the method for detecting aspirin and nitroglycerin drug-resistant SNP sites and special primers

[0067] 1. Special primers for detecting aspirin and nitroglycerin resistance SNP loci

[0068] According to the related SNP loci rs5918, rs1330344, rs20417 and rs671 of aspirin and nitroglycerin resistance genes, specific PCR primers and UEP primers were designed, and aspirin and nitroglycerin were detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology. Nitroglycerin resistance gene detection.

[0069] Specific PCR primers and UEP primers include:

[0070] rs5918PCR primer 1: ACGTTGGGATGTCTTTTGGGCTCCTGTCTTAC (SEQ ID NO: 1);

[0071] rs5918 PCR primer 2: ACGTTGGATGAGCAGATTCTCCTTCAGGTC (SEQ ID NO: 2);

[0072] rs1330344 PCR primer 1: ACGTTGGATGAGGTCACGCTATGGAAGAAG (SEQ ID NO: 3);

[0073] rs1330344 PCR primer 2: ACGTTGGATGAAGAAACACTTGTGTGGCCC (SEQ ID NO: 4);

[0074] rs20417 PCR primer 1: ACGTTGGAT...

Embodiment 2

[0114] Example 2, the method for detecting aspirin and nitroglycerin resistance SNP sites and the application of special primers

[0115] 1. Extraction of template DNA

[0116] The peripheral blood of 5 subjects (all with symptoms such as hypertension and thrombus) was used as samples 1-5 to be tested, and DNA was extracted according to the method of 2-1 of Example 1.

[0117] 2. PCR reaction: same as 2 of embodiment 1.

[0118] 3. Alkaline phosphatase treatment (SAP digestion reaction): the same as 3 of 2 of Example 1.

[0119] 4. Single base extension reaction: the same as 4 of 2 of Example 1.

[0120] 5. Resin purification: the same as the second part of 5 of embodiment 1.

[0121]6. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) detection:

[0122] Method is identical with embodiment 1 two 6, the result is as follows table 2:

[0123] Table 2 is the SNP site of the sample to be tested

[0124] sample 1 sample...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A method and special-purpose primers used for detecting aspirin and nitroglycerin accurate administration are provided. The special-purpose primers for detecting aspirin and nitroglycerin drug resistance SNP loci are provided and include a primer group 1 and a primer group 2. The primer group 1 includes a primer pair 1, a primer pair 2, a primer pair 3 and a primer pair 4. The primer group 2 includes a single-chain extension primer 1, a single-chain extension primer 2, a single-chain extension primer 3 and a single-chain extension primer 4. An experiment proves that detection of a plurality of SNP loci related to aspirin and nitroglycerin drug resistance is completed efficiently by a one-time experiment, and the one-time experiment can complete aspirin and nitroglycerin accurate administration gene detection, thus reducing the experiment cost. The method and the primers have high application value for directing clinical accurate administration of aspirin and nitroglycerin and are suitable for popularization and application.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting aspirin and nitroglycerin for precise drug use and special primers. Background technique [0002] Precision medicine is an important part of precision medicine. Pharmacogenetics and pharmacogenomics studies have confirmed that different patients carry different single nucleotide polymorphisms in genes (such as drug transporter genes, drug metabolism enzyme genes, DNA repair genes), and have different responses to drugs. The curative effect of different patients is also very different. Therefore, from the perspective of drug efficacy, genetic testing can be used to guide precise medication, help doctors to screen out effective treatment options, and make the most correct treatment decisions for patients, which not only saves patients Ineffective medical expenses, but also improve the treatment effect. [0003] Aspirin is a basic drug commonly used in clinical ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/106C12Q2600/156
Inventor 李爱娟谢文博赵菁
Owner 李爱娟
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap