Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for identifying cherry variety

A technology for variety identification and identification method, applied in the field of molecular identification of cherry varieties, can solve problems such as confusion, cherry industry losses, difficulties in sweet cherry variety breeding and property rights protection, etc., and achieve the effect of reducing experimental costs and accurate test results.

Active Publication Date: 2017-07-18
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, most of the varieties widely cultivated in various cultivation areas in China are imported from abroad. With the gradual increase in the number of sweet cherry varieties and the frequent exchange of germplasm, as well as the established pattern of multi-plant breeding and multi-management, different species with the same name or different The name phenomenon is very common, which not only brings many difficulties and confusion to sweet cherry variety breeding and property rights protection, but also causes serious losses to the cherry industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying cherry variety
  • Method for identifying cherry variety
  • Method for identifying cherry variety

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Establishment of a cherry variety identification method based on S genotype information and SSR core primer combination

[0039] 1. Materials and methods

[0040] 1.1 Material

[0041] A total of 87 sweet cherry varieties were tested, all of which were taken from the Cherry Germplasm Resource Nursery of Zhengzhou Institute of Fruit Science, Chinese Academy of Agricultural Sciences.

[0042] 1.2 Method

[0043] 1.2.1 DNA extraction and primer synthesis

[0044] Take new shoots and tender leaves in spring, extract leaf genomic DNA by CTAB method, and then store them in a refrigerator at -20℃. According to previous literature, 48 pairs of SSR primers evenly distributed on 8 chromosomes of sweet cherry (Table 1) were selected, and 1 pair of primers for amplification of S allele (Pru-T2 (GTTCTTGCTTTTGCTTTCTTC) and SI 32 (CATAGGCCATGGATGGTG) were selected at random. Amplify the 12 varieties of the selected primers, and modify the 5'end of the upstream primers with FAM (blue)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying a cherry variety, and belongs to the field of molecule identification of cherry varieties. The invention firstly discloses 11 pairs of SSR (Simple Sequence Repeats) primers for identifying the varieties of cherry, wherein the nucleotide sequences of the primers are as shown in SEQ ID No.1 to SEQ ID No.22. By adopting the method, core primer combinations are further screened from the 11 pairs of the SSR primers, 87 cherry germplasms can be distinguished by using 5 core primer combinations, and the obtained primer combinations have the advantages of being high in polymorphism, high in amplification stability, good in repeatability, clear in electrophoretic band and the like. The invention further discloses a cherry variety identification method and a kit based on S genotype information and SSR primer combinations. By adopting the primers, identification upon different cherry varieties can be rapidly and accurately completed. The SSR primer pairs, the cherry variety identification method and the kit disclosed by the invention can be applied to cherry germplasm evaluation, cherry germplasm innovation, parent choice for breeding, and the like.

Description

Technical field [0001] The invention relates to a cherry variety identification method, in particular to a cherry variety identification method based on the combination of S genotype information and SSR core primers, and belongs to the field of molecular identification of cherry varieties. Background technique [0002] In the past 20 years, China's sweet cherry industry has rapidly expanded from traditionally planted Shandong and Liaoning to Henan, Shanxi, Shaanxi, Gansu, Jiangsu and other provinces along the Longhai Railway, as well as cold highlands such as Yunnan, Guizhou and Sichuan. As of the spring of 2016, China’s sweet cherry cultivation area has reached 153,300 ha 2 . However, at present, most of the widely cultivated varieties in various cultivation areas in China are introduced abroad. With the gradual increase in the number of sweet cherry varieties and the increasing frequency of germplasm exchanges, and the established pattern of multiple breeding and multiple manag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 刘聪利李明齐希梁李玉红邱新强丁金鸽
Owner ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More