Method for identifying cherry variety
A technology for variety identification and identification method, applied in the field of molecular identification of cherry varieties, can solve problems such as confusion, cherry industry losses, difficulties in sweet cherry variety breeding and property rights protection, etc., and achieve the effect of reducing experimental costs and accurate test results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Establishment of a cherry variety identification method based on S genotype information and SSR core primer combination
[0039] 1. Materials and methods
[0040] 1.1 Material
[0041] A total of 87 sweet cherry varieties were tested, all of which were taken from the Cherry Germplasm Resource Nursery of Zhengzhou Institute of Fruit Science, Chinese Academy of Agricultural Sciences.
[0042] 1.2 Method
[0043] 1.2.1 DNA extraction and primer synthesis
[0044] Take new shoots and tender leaves in spring, extract leaf genomic DNA by CTAB method, and then store them in a refrigerator at -20℃. According to previous literature, 48 pairs of SSR primers evenly distributed on 8 chromosomes of sweet cherry (Table 1) were selected, and 1 pair of primers for amplification of S allele (Pru-T2 (GTTCTTGCTTTTGCTTTCTTC) and SI 32 (CATAGGCCATGGATGGTG) were selected at random. Amplify the 12 varieties of the selected primers, and modify the 5'end of the upstream primers with FAM (blue)...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com