Application of transcription factor vp1 in regulating plant height and grain starch content of crops

A technology of transcription factors and starch content, applied in the field of genetic engineering breeding of crops, can solve the problem of not being able to significantly increase starch content, and achieve the effect of improving corn plant type and grain quality

Inactive Publication Date: 2020-12-29
SICHUAN AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These studies showed that increasing the expression of individual starch biosynthesis-related genes did not significantly increase starch content

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of transcription factor vp1 in regulating plant height and grain starch content of crops
  • Application of transcription factor vp1 in regulating plant height and grain starch content of crops
  • Application of transcription factor vp1 in regulating plant height and grain starch content of crops

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The preparation of embodiment 1 transcription factor VP1 gene

[0045] The invention uses the mRNA of immature corn seeds as a template to synthesize a corn grain cDNA library and clones the corn transcription factor VP1 gene by using a PCR method. Using grain cDNA as a template, the maize VP1 gene was amplified with KOD enzyme, and a specific target product band was amplified with a molecular weight of about 2.1 kb, which was consistent with the expected value. The PCR product of the VP1 gene was directly connected to the pMD19-T vector after purification, and the plasmid DNA was extracted from the positive clone and analyzed by restriction endonuclease. It was confirmed that the size of VP1 cloned by PCR method was correct, and the DNA sequence sequence confirmed it. The cloned gene is VP1. The primer sequence used to amplify the full-length sequence of the VP1 coding region is: 5' end primer 5'- GGATCC ATGGAAGCCTCCTCCGGCTC-3' (SEQ ID NO.3), 3' end primer 5'- GAG...

Embodiment 2

[0048] Example 2 Transformation of corn backbone inbred lines with plant expression vectors containing the VP1 gene

[0049] Contain the plant expression vector construction of VP1 gene: the plant overexpression vector that the present invention selects is pCAMBIA3301, at first design contains HindIII and BamHI specific primer (5 ' end primer: AAGCTT ATCAGTGGCCAGCTTTTGTTCTA (SEQ ID NO.5) and 3' end primer: GGATCC AAGTAACACCAAACAACAGGGT (SEQ ID NO.6)), the promoter sequence of Ubiquitin gene (GenBank accession number: U29159.1) is amplified with maize genomic DNA as a template, and then the VP1 specific primer containing BamHI and SacI described in Example 1 is used (5'- GGATCC ATGGAAGCCTCCTCCGGCTC-3' (SEQ ID NO.3), 5'- GAGCTC AGATGCTCACCGCCATCTGG-3'(SEQ ID NO.4)), using the corn cDNA library as a template to amplify the full-length sequence of the VP1 gene, and then connecting the two fragments into the intermediate vector pBI221 containing the Nos terminator, and finall...

Embodiment 3

[0052] Example 3 Detection and Utilization of Transgenic Corn Plants

[0053] After the transgenic T0 generation seedlings were transplanted into the field, the leaves of the seedlings were taken for GUS staining, and leaf DNA was extracted, and the gene transformation was detected by PCR method, and the seedling plants with GUS staining blue and PCR target bands were regarded as transgenic positive plants ( Figure 10 ), extract RNA from leaves of positive plants, carry out RT-PCR analysis after reverse transcribing cDNA, and detect the expression of VP1 gene in transgenic plants ( Figure 11 ), to screen the transgenic plants with significant overexpression of VP1 gene, bagged self-cross or sister cross to set fruit.

[0054] The seeds produced by the positive T0 generation plants were planted in addition (in order to prevent the problem of different stages of male and female development, they were planted in two batches with an interval of 10 days), and the T1 generation p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a maize transcription factor VP1 in regulating crop plant height and grain starch content. The maize transcription factor VP1 is inserted into a plant expression carrier carrying a plant selection gene, a target gene is started by a maize combined type Ubiquitin promoter, a selectable marking gene hptII is started by a 35S promoter from cauliflower mosaic virus; through genetic transformation of maize embryo callus mediated by agrobacteria, transgenic plants are obtained in batch. According to the maize transcription factor VP1 in regulating the crop plant height and grain starch content, the plant height and grain characters of homozygous strains of a transgenic offspring are authenticated, as is shown, compared with a wild type plant, the plant height of an overexpression VP1 gene plant is reduced by about 35%, and the starch content of seeds is increased by around 3%. A new path is opened up for increasing the height of plants of graminaceous crops like maize, sorghum, rice, and wheat, and increasing the content of grain starch of the graminaceous crops.

Description

technical field [0001] The invention belongs to the field of genetic engineering breeding of crops, and in particular relates to the application of a transcription factor VP1 in regulating crop height and grain starch content. Background technique [0002] Starch is the main carbohydrate component of human food and livestock feed. It is also widely used in industry and other fields, and occupies a very important position in the national economy. With energy shortages and population growth, the demand for starch is increasing. Genetic An improved method to obtain corn with high starch content is the way to meet this demand. Corn is one of the important raw materials for making starch. Because corn has the characteristics of high yield, strong adaptability, and easy planting, it has the following characteristics as a raw material for starch processing: the quality of corn starch is good; under the same processing equipment conditions, the output The flour rate is 2% to 4% hig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/10A01H4/00A01H6/46
CPCA01H4/00C07K14/415C12N15/8245C12N15/8261
Inventor黄玉碧李炀平胡育峰张军杰刘汉梅刘应红余国武龙田丹
OwnerSICHUAN AGRI UNIV