Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction
A technology of acute myocardial infarction and markers, which can be used in the determination/testing of microorganisms, measuring devices, biomaterial analysis, etc., and can solve the problem of low expression of PRMT5 gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Using the genomic DNA extracted from the peripheral blood of subjects or patients with acute myocardial infarction as a template, the primer pair P sequence of the specific detection gene used for fluorescent quantitative detection of PRMT5 gene mRNA expression level is as follows:
[0026] Upstream primer sequence: 5'TGTAGGGAGAAGGACCGTGA 3'
[0027] Downstream primer sequence: 5'ATGGCTGAAGGTGAAACAGG 3'.
[0028] Described fluorescent quantitative PCR reaction system: 20ul reaction system, each reaction comprises: 10ul SYBR PremixEx Taq TM, each 0.5ul of upstream and downstream primers (concentration is 10umol / L), nuclease-free double distilled water 8ul, cDNA template 1ul;
[0029] The fluorescent quantitative PCR reaction conditions: use real-time fluorescent quantitative PCR system to amplify. The reaction conditions are pre-denaturation at 95°C for 10 minutes; 40 cycles: denaturation at 95°C for 15 seconds, annealing at 60°C for 20 seconds, extension at 72°C for 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


