Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction

A technology of acute myocardial infarction and markers, which can be used in the determination/testing of microorganisms, measuring devices, biomaterial analysis, etc., and can solve the problem of low expression of PRMT5 gene

Inactive Publication Date: 2017-08-18
JILIN UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the PRMT5 gene showed a significantly low expression in the peripheral blood of patients with acute myocardial infarction, and there was no report on the relationship between PRMT5 gene and myocardial infarction in the existing studies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction
  • Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction
  • Application of PRMT5 gene serving as marker for predicting, diagnosing and treating acute myocardial infarction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Using the genomic DNA extracted from the peripheral blood of subjects or patients with acute myocardial infarction as a template, the primer pair P sequence of the specific detection gene used for fluorescent quantitative detection of PRMT5 gene mRNA expression level is as follows:

[0026] Upstream primer sequence: 5'TGTAGGGAGAAGGACCGTGA 3'

[0027] Downstream primer sequence: 5'ATGGCTGAAGGTGAAACAGG 3'.

[0028] Described fluorescent quantitative PCR reaction system: 20ul reaction system, each reaction comprises: 10ul SYBR PremixEx Taq TM, each 0.5ul of upstream and downstream primers (concentration is 10umol / L), nuclease-free double distilled water 8ul, cDNA template 1ul;

[0029] The fluorescent quantitative PCR reaction conditions: use real-time fluorescent quantitative PCR system to amplify. The reaction conditions are pre-denaturation at 95°C for 10 minutes; 40 cycles: denaturation at 95°C for 15 seconds, annealing at 60°C for 20 seconds, extension at 72°C for 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a PRMT5 gene serving as a marker for predicting, diagnosing and treating acute myocardial infarction and relates to peripheral blood acute myocardial infarction marker detection and application thereof. The PRMT5 gene or the expression product thereof is used as a new target for predicting, diagnosing and treating the acute myocardial infarction, the PRMT5 gene or the expression product thereof are used to prepare a preparation for predicting, diagnosing and treating the acute myocardial infarction, and important clinical application significance and a high development value are achieved.

Description

[0001] Field of invention: [0002] The invention discloses the use of a PRMT5 gene as a marker for predicting diagnosis and treatment of acute myocardial infarction, relates to the detection and application of markers for acute myocardial infarction in peripheral blood, and belongs to the fields of disease risk prediction and evaluation, gene diagnosis and biomedicine. [0003] Background of the invention: [0004] Myocardial infarction is a global disease characterized by high morbidity and mortality. Every year, more than 3 million people are newly diagnosed with ST-segment elevation myocardial infarction, and more than 4 million people are newly diagnosed with non-ST-segment elevation myocardial infarction. The incidence of myocardial infarction is relatively high in developed countries, and the incidence in developing countries such as China is showing a rapid upward trend. Epidemiological and basic science studies have shown that lifestyle factors and genetic factors joi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N33/573
CPCC12Q1/6883C12Q2600/158G01N33/573G01N2333/91017
Inventor 孟繁波谭卜川杨丽萍刘谦张文杨玉双刘龙
Owner JILIN UNIV