Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia

An arginine methyl, transferase technology, applied in gene therapy, application, genetic engineering and other directions, can solve the problems of myeloid leukemia, mixed leukemia treatment effect is not ideal, the pathogenesis of leukemia is unclear, and the treatment of children fails. , to achieve the effect of high sensitivity, simple detection method and low cost

Inactive Publication Date: 2009-07-22
BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the continuous improvement of chemotherapy regimens and the improvement of supportive treatment, the treatment of leukemia has been greatly improved, and the long-term disease-free survival rate of children with acute lymphoblastic leukemia (Acute Lymphoblastic Leukemia, ALL) has reached more than 80% (BFM-oriented treatment for children with acute lymphoblastic leukemia without cranialirradiation and treatment reduction for standard risk patients:results ofDCLSG protocol ALL-8(1991-1996).Leukemia.2002,16:1099-1111;Improvedoutcome in Childhood acute lymphoblastic leukemia despite reduced use ofanthracyclines and cranial radiotherapy: Results of trial ALL-BFM 90.Blood.2000, 95:3310-3322; Long-term results of the Italian Association of Pediatric Hematology and Oncology (AIEOP) Acute Lymphoblastic Leukemia studies, 1982-1995.Leukemia.2000,14:2196- 2204; Children's Cancer Group trials in children acute lymphoblastic leukemia: 1983-1995. Leukemia.2000, 14: 2196-2204), but the pathogenesis of leukemia is still unclear, and some children have failed treatment and relapsed. In addition, myeloid leukemia, The treatment effect of mixed leukemia is still unsatisfactory

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia
  • Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia
  • Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Detecting the expression of PRMT5 in the bone marrow cells of children with leukemia

[0050] 1. Western blot detection of PRMT5 expression in bone marrow cells of children with leukemia

[0051] 1. Bone marrow collection

[0052] The bone marrow of the 149 children with newly diagnosed leukemia, 23 children with remission, 25 children with drug withdrawal, 13 children with idiopathic thrombocytopenic purpura, and 24 children with orthopedic surgery in Beijing Children's Hospital (normal control group) were collected. Bone marrow, the specific method is as follows:

[0053] Extract 2 mL of bone marrow under sterile conditions from different parts (such as sternum, iliac crest, thoracic vertebrae or tibia) of children with newly diagnosed leukemia, children in remission, children with drug withdrawal and children in the control group, add ethylenediaminetetraacetate ( EDTA) anticoagulation. Bone marrow specimen collection requirements: EDTA anticoagulant, b...

Embodiment 2

[0125] Embodiment 2, detection of the inhibitory effect of siRNA of PRMT5 on tumor cells

[0126] 1. Design of PRMT5 siRNA and synthesis of its encoding DNA

[0127] 1. Design of PRMT5 siRNA

[0128] Four pairs of siRNAs were designed according to four segments of PRMT5 mRNA (288-308 (ggagaagattcgcaggaactc), 626-646 (ggggctgacctcccatctaatc), 852-872 (ggaatacttaagccagaaccg), 1228-1248 (ggaagccaagtgaccgtagtc)), and the sequences were as follows:

[0129] siRNA1:

[0130] Sense strand: 5'-ggagaagauucgcaggaacuc-3' (sequence 1 in the sequence listing)

[0131] Antisense strand: 5'-gaguuccugcgaaucuucucc-3' (sequence 2 in the sequence listing);

[0132] siRNA2:

[0133] Sense strand: 5'-gggcugaccucccaaucuaauc-3' (sequence 3 in the sequence listing)

[0134] Antisense strand: 5'-gauuagaugggaggucagccc-3' (sequence 4 in the sequence listing);

[0135] siRNA3:

[0136] Sense strand: 5'-ggaauacuuaagccagaaccg-3' (sequence 5 in the sequence listing)

[0137] Antisense strand: 5'-cgg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of PRMT5 in the detection and treatment of leukemia cells. The invention also provides small interfering RNA for inhibiting the expression of PRMT5 gene. Experiments have proved that the small interfering RNA of the present invention has a significant inhibitory effect on the PRMT5 gene. In addition, by silencing the PRMT5 gene, the proliferation of PRMT5 gene-deficient cells can be inhibited, indicating that the PRMT5 gene can be used as a drug target for treating leukemia and tumors. Therefore, the coding sequence of the small interfering RNA that inhibits the expression of the PRMT5 gene can be used as an active ingredient to prepare leukemia and tumor therapeutic drugs. The invention has great practical significance and broad application prospects in the fields of medicine and biopharmaceuticals.

Description

technical field [0001] The invention relates to a new application of protein arginine methyltransferase 5 (Protein Arginine Methyltransferase 5, PRMT5), in particular to the application of PRMT5 in the detection and treatment of leukemia cells. Background technique [0002] Protein arginine methyltransferases, namely the PRMT family, have been found to have 8 members in mammalian cells, namely PRMT1-8. These eight enzymes can be divided into two categories according to the specificity of substrates and reaction products. The common feature of the two types of enzymes is that they can both catalyze the monomethylation of protein arginine; the difference between the two types of enzymes is that one type of PRMTs can catalyze the asymmetric double methylation of protein arginine, while the second type PRMT can catalyze the symmetrical dimethylation of arginine. Except PRMT5 and PRMT7 belong to the second type of catalyzing the monomethylation and symmetrical dimethylation of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/48C12Q1/68C12N15/54C12N15/63A61K48/00A61P35/02
Inventor 鲍时来郑胡镛周忠卫张瑞东
Owner BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products