Application of protein arginine methyl transferase 5 in cell detection and treatment of leukemia
An arginine methyl, transferase technology, applied in gene therapy, application, genetic engineering and other directions, can solve the problems of myeloid leukemia, mixed leukemia treatment effect is not ideal, the pathogenesis of leukemia is unclear, and the treatment of children fails. , to achieve the effect of high sensitivity, simple detection method and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1. Detecting the expression of PRMT5 in the bone marrow cells of children with leukemia
[0050] 1. Western blot detection of PRMT5 expression in bone marrow cells of children with leukemia
[0051] 1. Bone marrow collection
[0052] The bone marrow of the 149 children with newly diagnosed leukemia, 23 children with remission, 25 children with drug withdrawal, 13 children with idiopathic thrombocytopenic purpura, and 24 children with orthopedic surgery in Beijing Children's Hospital (normal control group) were collected. Bone marrow, the specific method is as follows:
[0053] Extract 2 mL of bone marrow under sterile conditions from different parts (such as sternum, iliac crest, thoracic vertebrae or tibia) of children with newly diagnosed leukemia, children in remission, children with drug withdrawal and children in the control group, add ethylenediaminetetraacetate ( EDTA) anticoagulation. Bone marrow specimen collection requirements: EDTA anticoagulant, b...
Embodiment 2
[0125] Embodiment 2, detection of the inhibitory effect of siRNA of PRMT5 on tumor cells
[0126] 1. Design of PRMT5 siRNA and synthesis of its encoding DNA
[0127] 1. Design of PRMT5 siRNA
[0128] Four pairs of siRNAs were designed according to four segments of PRMT5 mRNA (288-308 (ggagaagattcgcaggaactc), 626-646 (ggggctgacctcccatctaatc), 852-872 (ggaatacttaagccagaaccg), 1228-1248 (ggaagccaagtgaccgtagtc)), and the sequences were as follows:
[0129] siRNA1:
[0130] Sense strand: 5'-ggagaagauucgcaggaacuc-3' (sequence 1 in the sequence listing)
[0131] Antisense strand: 5'-gaguuccugcgaaucuucucc-3' (sequence 2 in the sequence listing);
[0132] siRNA2:
[0133] Sense strand: 5'-gggcugaccucccaaucuaauc-3' (sequence 3 in the sequence listing)
[0134] Antisense strand: 5'-gauuagaugggaggucagccc-3' (sequence 4 in the sequence listing);
[0135] siRNA3:
[0136] Sense strand: 5'-ggaauacuuaagccagaaccg-3' (sequence 5 in the sequence listing)
[0137] Antisense strand: 5'-cgg...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



