Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Truncated protein for reading through premature termination codons diseases by using inhibitory transfer ribonucleic acids (tRNAs)

A truncated protein, inhibitory technology, used in DNA/RNA fragments, muscle system diseases, recombinant DNA technology, etc., to restore normal structure and function

Active Publication Date: 2017-09-19
PEKING UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since PTC exists in about 30% of human genetic diseases, but the research on the read-through of human genetic disease-related proteins by inhibitory tRNA is still unclear. Therefore, using the construction of inhibitory tRNA to extend the truncated protein of the nonsense mutant of the disease-causing gene, It is very important to produce full-length functional proteins in mammalian cells, thereby restoring the normal structure and function of mutants
On the other hand, although inhibitory tRNA can restore the expression of proteins containing nonsense mutations, it is still unknown what the difference is in the read-through efficiency of different inhibitory tRNAs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Truncated protein for reading through premature termination codons diseases by using inhibitory transfer ribonucleic acids (tRNAs)
  • Truncated protein for reading through premature termination codons diseases by using inhibitory transfer ribonucleic acids (tRNAs)
  • Truncated protein for reading through premature termination codons diseases by using inhibitory transfer ribonucleic acids (tRNAs)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: the acquisition of 19 kinds of inhibitory tRNA

[0039] (1) Determination of 19 inhibitory tRNAs

[0040] According to the mutation characteristics of human PTC disease, determine the tRNA sequences corresponding to 19 kinds of amino acid codons that can undergo nonsense mutations, change the tRNA anticodon loop to obtain inhibitory tRNAs that are completely complementary to the premature stop codon, and 19 inhibitory tRNAs The tRNAs are respectively, Amber inhibitory tRNA: inhibitory tRNA (Gln / UAG), inhibitory tRNA (Tyr / UAG), inhibitory tRNA (Lys / UAG), inhibitory tRNA (Leu / UAG), inhibitory tRNA (Glu / UAG), inhibitory tRNA(Trp / UAG); Opal inhibitory tRNA: inhibitory tRNA(Arg / UGA), inhibitory tRNA(Gln / UGA), inhibitory tRNA(Trp / UGA), inhibitory tRNA(Gly / UGA), inhibitory tRNA (Cys / UGA), inhibitory tRNA (Leu / UGA), inhibitory tRNA (Ser / UGA); Ocher inhibitory tRNA: inhibitory tRNA (Gln / UAA), inhibitory tRNA (Tyr / UAA), inhibitory tRNA(Lys / UAA), inhibitory tRNA...

Embodiment 2

[0052] Example 2: Detection of read-through efficiencies of 19 inhibitory tRNAs using dual fluorescein reporter genes and point-mutated GFP reporter genes

[0053] (1) Construction of GFP reporter gene containing premature stop codon

[0054] Green fluorescent protein GFP is the most commonly used reporter gene, and it is also a powerful tool to indicate the insertion of unnatural amino acids. It consists of 238 amino acids, and its gene sequence is shown in SEQ ID NO: 21.

[0055] The GFP sequence was inserted into the pcDNA3.1 commercial plasmid, and the 39th amino acid codon of the GFP fluorescent gene was point-mutated into three premature stop codons of UAG, UAA and UGA. Design primers capable of mutating the codon encoding the amino acid into three stop codons respectively, and the specific primers are shown in the table below.

[0056] Table 4 GFP mutation primer list

[0057] GFP-39-UAG-for

GGCGAGGGCGATGCCACCTAGGGCAAGCTGACCCTGAAGTTC

GFP-39-UAG-for...

example 3

[0069] Example 3: Readthrough of the disease protein Dystrophin in the 293T cell line

[0070] (1) Construction of Dp71b mutant plasmids containing premature stop codons UAG, UAA, UGA

[0071] The homologous Dp71b sequence of the Dystrophin protein is shown in SEQ ID NO: 23. According to the site of the nonsense mutation in Duchenne muscular dystrophy, the inventors carried out point mutations on the wild-type Dp71b sequence, and introduced premature stop codons at different positions Construct Dp71b containing premature stop codon UAG 3115TAG , mutated to c.9346C>T, Dp71b containing premature stop codon UAA 3216TAA , mutated to c.9651C>A; Dp71b containing premature stop codon UGA 3112TGA , the mutation was c.9337C>T, and the mutation was successfully verified by sequencing.

[0072] (2) Read-through disease protein Dystrophin in 293T cell line

[0073] The Dp71b obtained in step 1 of embodiment 3 3115TAG , Dp71b 3216TAA , Dp71b 3112TGA The plasmid and the corresponding...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a truncated protein for prolonging a disease-causing gene nonsense mutant by establishing inhibitory transfer ribonucleic acids (tRNAs) so as to enable full-length functional proteins to be produced in mammalian cells and further restore the normal structure and function of the mutant. A nonsense mutation system related in the invention comprises disease-causing genes of single gene inheritance diseases and tumor suppressor genes in tumor cells. The invention mainly relates to constructing of nineteen inhibitory tRNAs corresponding three termination codons, a dystrophin protein is efficiently read through in the mammalian cells, and a nonsense mutant protein is read through in the tumor cells, so that a remarkable effect is achieved.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals, and specifically relates to the construction of inhibitory tRNA to extend the truncated protein of the nonsense mutant of the disease-causing gene to produce full-length functional protein in mammalian cells, thereby restoring the normal structure and function of the mutant. The invention mainly involves the construction of 19 inhibitory tRNAs corresponding to three stop codons, which can read through dystrophin protein in mammalian cells and read through nonsense mutant proteins in tumor cells, and have remarkable effects. Background technique [0002] Nonsense mutations and the genetic diseases caused by them [0003] There are many types of gene mutations in the human genome, and nonsense mutations are one of the gene mutations. Gene mutations are heritable variations in genomic DNA molecules, including frameshift mutations and base substitutions. Frameshift mutations include base insertion...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113A61P35/00
CPCC12N15/113C12N15/1135C12N2310/10C12N15/11C12N15/63A61P21/00A61P35/00C12N15/85A61K48/00
Inventor 夏青王天畅杨琦
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com