Truncated protein for reading through premature termination codons diseases by using inhibitory transfer ribonucleic acids (tRNAs)
A truncated protein, inhibitory technology, used in DNA/RNA fragments, muscle system diseases, recombinant DNA technology, etc., to restore normal structure and function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1: the acquisition of 19 kinds of inhibitory tRNA
[0039] (1) Determination of 19 inhibitory tRNAs
[0040] According to the mutation characteristics of human PTC disease, determine the tRNA sequences corresponding to 19 kinds of amino acid codons that can undergo nonsense mutations, change the tRNA anticodon loop to obtain inhibitory tRNAs that are completely complementary to the premature stop codon, and 19 inhibitory tRNAs The tRNAs are respectively, Amber inhibitory tRNA: inhibitory tRNA (Gln / UAG), inhibitory tRNA (Tyr / UAG), inhibitory tRNA (Lys / UAG), inhibitory tRNA (Leu / UAG), inhibitory tRNA (Glu / UAG), inhibitory tRNA(Trp / UAG); Opal inhibitory tRNA: inhibitory tRNA(Arg / UGA), inhibitory tRNA(Gln / UGA), inhibitory tRNA(Trp / UGA), inhibitory tRNA(Gly / UGA), inhibitory tRNA (Cys / UGA), inhibitory tRNA (Leu / UGA), inhibitory tRNA (Ser / UGA); Ocher inhibitory tRNA: inhibitory tRNA (Gln / UAA), inhibitory tRNA (Tyr / UAA), inhibitory tRNA(Lys / UAA), inhibitory tRNA...
Embodiment 2
[0052] Example 2: Detection of read-through efficiencies of 19 inhibitory tRNAs using dual fluorescein reporter genes and point-mutated GFP reporter genes
[0053] (1) Construction of GFP reporter gene containing premature stop codon
[0054] Green fluorescent protein GFP is the most commonly used reporter gene, and it is also a powerful tool to indicate the insertion of unnatural amino acids. It consists of 238 amino acids, and its gene sequence is shown in SEQ ID NO: 21.
[0055] The GFP sequence was inserted into the pcDNA3.1 commercial plasmid, and the 39th amino acid codon of the GFP fluorescent gene was point-mutated into three premature stop codons of UAG, UAA and UGA. Design primers capable of mutating the codon encoding the amino acid into three stop codons respectively, and the specific primers are shown in the table below.
[0056] Table 4 GFP mutation primer list
[0057] GFP-39-UAG-for
GGCGAGGGCGATGCCACCTAGGGCAAGCTGACCCTGAAGTTC
GFP-39-UAG-for...
example 3
[0069] Example 3: Readthrough of the disease protein Dystrophin in the 293T cell line
[0070] (1) Construction of Dp71b mutant plasmids containing premature stop codons UAG, UAA, UGA
[0071] The homologous Dp71b sequence of the Dystrophin protein is shown in SEQ ID NO: 23. According to the site of the nonsense mutation in Duchenne muscular dystrophy, the inventors carried out point mutations on the wild-type Dp71b sequence, and introduced premature stop codons at different positions Construct Dp71b containing premature stop codon UAG 3115TAG , mutated to c.9346C>T, Dp71b containing premature stop codon UAA 3216TAA , mutated to c.9651C>A; Dp71b containing premature stop codon UGA 3112TGA , the mutation was c.9337C>T, and the mutation was successfully verified by sequencing.
[0072] (2) Read-through disease protein Dystrophin in 293T cell line
[0073] The Dp71b obtained in step 1 of embodiment 3 3115TAG , Dp71b 3216TAA , Dp71b 3112TGA The plasmid and the corresponding...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



