Mevalonic acid pathway tuned by TIGR

A pathway and sequence technology, applied in the field of zeaxanthin production, can solve the problems of uncoordinated expression, uncoordinated expression between genes, accumulation of intermediate products, etc.

Inactive Publication Date: 2017-09-22
辛珉
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, the MEV pathway they introduced did not consider the coordinated expression of each gene in the pathway. The uncoordinated expression of genes in the MEV pathway leads to the accumulation of MEV pathway intermediates, which are toxic to cells.
So far, the MEV pathway has not been introduced into E. coli for the production of zeaxanthin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mevalonic acid pathway tuned by TIGR
  • Mevalonic acid pathway tuned by TIGR
  • Mevalonic acid pathway tuned by TIGR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0116] Construction of the MEV upstream pathway regulated by embodiment 1 TIGR

[0117] 1) Using F1 / F2 as primers, Escherichia coli DH5 The genome is used as a template, the atoB gene is amplified by PCR, and connected to the pBAD33 vector to obtain pBAD33-atoB;

[0118] 2) Using F3 / F4 as primers and the Saccharomyces cerevisiae genome as a template, PCR amplifies the HMGS gene and connects it to the pMD18-T vector to obtain pMD-HMGS;

[0119] 3) Using F5 / F6 as primers and Saccharomyces cerevisiae genome as a template, PCR amplifies the tHMGR gene, and connects it to the pMD18-T vector to obtain pMD-tHMGR;

[0120] 4) PCR amplification with F7 / F8 as primers and pMD-HMGS as template; PCR amplification with F9 / F6 as primers and pMD-tHMGR as template;

[0121] 5) Using F7 / F6 as primers and the two PCR fragments recovered from the gel in the previous step as templates, amplify by PCR, connect to the SmaI / PstI space of pBAD33-atoB, and obtain pBAD33-MevTTIGR.

[0122] 6) Digest...

Embodiment 2

[0141] Example 2 MEV downstream pathway pBAD24-MevBIS

[0142] 1) Using F10 / F11, F12 / F13, and F14 / F15 as primers and Saccharomyces cerevisiae genome as a template, PCR amplifies ERG12, ERG19, and ERG8 genes, and connects them to pBAD24 to obtain pBAD24-MevB.

[0143] SEQ ID NO.14

[0144] F10:CTAGCTAGCTTTCGGAATTAAAGGAGCATCAAATATGTCTCTGCCGTTCCTG(NheI)

[0145] SEQ ID NO.15

[0146] F11:CTACCCGGGAAACTCGAGTTATGAAGTCCATGGTAAATTCG(SmaI / XhoI)

[0147] SEQ ID NO.16

[0148] F12:GATCCCGGGTTTCGGAATTAAAGGAGCATCAAATATGACCGTTTACACGGCATCC(SmaI)

[0149] SEQ ID NO.17

[0150] F13: TGCCTGCAGCCAATCGATTTATTTCTTTGGTAGACCAG (PstI / ClaI)

[0151] SEQ ID NO.18

[0152] F14: ATTCTCGAGAAAAGGGCCCTTTCGGAATTAAAGGAGCATCAAATATGTCTGAGCTGCGTGCCTTCTCTGCCCCAGGT(XhoI / ApaI)

[0153] SEQ ID NO.19

[0154] F15: ATTCCCGGGAAAAACTAGTTTTATTTATCAAGATAAGTTTCCGGA(SmaI / SpeI)

[0155] 2) Using F16 / F17 as primers and the Escherichia coli genome as a template, PCR amplifies the idi gene, connects it to pMD-18T, an...

Embodiment 3

[0165] Embodiment 3 TIGR regulates the construction of MEV downstream pathway

[0166] 1) Insert the following TIGR sequence into pBAD24-MevBIS to obtain pBAD24-MevBTIGRIS

[0167] The TIGR sequence between ERG12 and ERG8 is SEQ ID NO.3:

[0168]TIGR3:5'-GCCTAGCAAGATCTCCTGATCCCGGTGCGCGACCACCCGGACATCTGCATAGTCTGGGTGGATCAGGTACACTTACACTTGCCTTGAATTTACAGTATTTCAGTTACCGCTCTATCCTTATCCTTATCCGCTCAAGATAACCGGATACCGGCCCGATCGGTACCGCAGATACTGAATCC-3'

[0169] The TIGR sequence between ERG8 and ERG19 is SEQ ID NO.4:

[0170] TIGR4:5'-GCCTAGCAAGATCTCCTGATCCACCTTTGATGGCTAGAAAAATTAAGCTGCGGACATCTGCATAGTCTGGGCCAGTCTGAGGACTGGCGGATCAGGGCCTTGAATTTACAGTATTTAATGAACTAGCGTTCCGAGTGCATGCCTTATCCGCTCAAGACATGCACTCGGAACGCATCTAGGGTACCGCAGATACTGTATCC-3'

[0171] The above TIGR sequence can be fully synthesized or obtained by screening the library method reported by Pfleger et al. (Nature Biotechnology 2006, 24:1027-1032).

[0172] 2) pBAD24-MevBTIGRIS was digested with NheI / PstI, and connected to the correspond...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biochemistry, and relates to an MEV (mevalonic acid) pathway tuned by TIGR (tunable intergenic regions) to produce isopentene compounds, especially zeaxanthin. In particular, the exogenous MEV pathway is introduced into the engineered escherichia coli (ZEAX) for producing zeaxanthin, especially an upstream pathway and a downstream pathway of MEV tuned by the TIGR are introduced to coordinate the production of intermediate products and reduce the toxicity to cells due to the accumulation of intermediate products, and finally the yield of zeaxanthin is increased.

Description

technical field [0001] The invention belongs to the field of biochemistry, and in particular relates to the production of zeaxanthin by using Escherichia coli recombinant engineering bacteria. Background technique [0002] Zeaxanthin is a high-value carotenoid, which is not only used as health care products, cosmetics, food, etc., but also widely used clinically to treat age-related macular degeneration. As the market demand for zeaxanthin continues to expand, the production methods of pro-zeaxanthin (chemical synthesis and direct purification from plants) are difficult to supply the market stably. Therefore, there is an urgent need to increase the yield of zeaxanthin. [0003] At present, several research groups have reported that engineering Escherichia coli can be used to produce zeaxanthin (Albrecht et al.Biotechnol Lett 1999,21(9):791-795; Nishizaki et al., Appl Environ Microbiol2007; 73(4):1355 -1361; Li et al., J Ind Microbiol Biot. 2015, 42, 627-636). Among them, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/54C12N15/53C12N15/60C12N15/61C12N15/66C12N1/21C12R1/19
CPCC12N15/113C12N9/0006C12N9/1025C12N9/1029C12N9/1085C12N9/1205C12N9/1229C12N9/88C12N9/90C12N15/66C12N2310/10C12Y101/01034C12Y203/01009C12Y203/0301C12Y205/0101C12Y207/01036C12Y207/04002C12Y401/01033C12Y503/03002
Inventor辛珉刘建忠
Owner辛珉