Right border flanking sequence of exogenous insertion segment of genetically modified corn HiII-NGc-1
A technology of transgenic corn and flanking sequences, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of high yield of corn varieties, increased pesticide usage, and reduced yield, etc., and achieve good agronomic traits , good accuracy and convenient detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Clone the flanking sequence of transgenic maize HiII-NGc-1
[0049] 1. Use the common CTAB method to extract the genomic DNA of the corn sample. The specific operation process is implemented in accordance with the Ministry of Agriculture Announcement No. 1485-4-2010, DNA extraction and purification for the detection of components of transgenic plants and their products. Wherein, the corn samples include transgenic corn HiII-NGc-1 and non-transgenic corn HiII.
[0050] 2. PCR amplification
[0051] Detect whether the transgenic corn HiII-NGc-1 positive material and non-transgenic corn HiII can amplify the cryNGc gene and bar gene: use the genomic DNA of corn as a template, perform PCR amplification, and amplify the cryNGc gene (981bp size), bar Gene (352bp size). Among them, the primer pairs used in PCR amplification are shown in Table 1, the PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.
[0052] Specific test res...
Embodiment 2
[0089] Example 2 Design and detect the primer pair of the right border side sequence of transgenic maize HiII-NGc-1, and carry out specific detection
[0090] Design primer AP2 according to the corn genomic DNA part in the right border flanking sequence of transgenic corn HiII-NGc-1, match with GSP2, carry out PCR detection with transgenic corn genomic DNA as template, PCR reaction system and reaction procedure are the same as embodiment 1, purpose The band size is 855bp. Among them, AP2: GACGAAGGTGATGTTTGCCGAAGGT (SEQ ID No. 10).
[0091]Select transgenic corn HiII-NGc-1, HiII-NGc-2, HiII-NGc-3, and non-transgenic corn HiII as templates. Genomic DNA of each material was extracted, and specific PCR detection was carried out. The PCR reaction system and reaction procedure were the same as in Example 1. Specific test results such as Figure 4 As shown, the genomic DNA of insect-resistant and herbicide-resistant corn HiII-NGc-1 can be amplified to obtain the target fragment, w...
Embodiment 3
[0092] Sensitivity detection of embodiment 3 specific primers
[0093] Genomic DNA of transgenic corn HiII-NGc-1 was extracted, and the DNA of HiII-NGc-1 was diluted according to 100%, 10%, 1%, 0.5%, 0.1%, 0.05%, and 0% (the DNA samples corresponding to each percentage The specific concentrations are 100ng / μl, 10ng / μl, 1ng / μl, 0.5ng / μl, 0.1ng / μl, 0.05ng / μl, 0ng / μl), which are used as templates for sensitivity detection. Genomic DNA samples with the above series of copy numbers were used as templates, and PCR amplification was performed using primers GSP2 and AP2. The reaction system and reaction procedure refer to Example 1. At the same time, a negative control with water instead of template DNA was set up in the experiment. The specific test results are as follows: Figure 5 shown.
[0094] The result shows: adopt primer GSP2 and AP3 to carry out PCR amplification, 0.5% genomic DNA sample (0.5ng / μl) can amplify the band that is 855bp in size (such as Figure 5 Show). The...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


