Unlock instant, AI-driven research and patent intelligence for your innovation.

Right border flanking sequence of exogenous insertion segment of genetically modified corn HiII-NGc-1

A technology of transgenic corn and flanking sequences, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of high yield of corn varieties, increased pesticide usage, and reduced yield, etc., and achieve good agronomic traits , good accuracy and convenient detection

Active Publication Date: 2018-01-16
JILIN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the seriousness of insect pests, the high yield of corn varieties cannot be exerted normally, resulting in a decrease in yield, a gradual increase in the use of pesticides, and serious ecological problems such as soil residues are becoming increasingly prominent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Right border flanking sequence of exogenous insertion segment of genetically modified corn HiII-NGc-1
  • Right border flanking sequence of exogenous insertion segment of genetically modified corn HiII-NGc-1
  • Right border flanking sequence of exogenous insertion segment of genetically modified corn HiII-NGc-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Clone the flanking sequence of transgenic maize HiII-NGc-1

[0049] 1. Use the common CTAB method to extract the genomic DNA of the corn sample. The specific operation process is implemented in accordance with the Ministry of Agriculture Announcement No. 1485-4-2010, DNA extraction and purification for the detection of components of transgenic plants and their products. Wherein, the corn samples include transgenic corn HiII-NGc-1 and non-transgenic corn HiII.

[0050] 2. PCR amplification

[0051] Detect whether the transgenic corn HiII-NGc-1 positive material and non-transgenic corn HiII can amplify the cryNGc gene and bar gene: use the genomic DNA of corn as a template, perform PCR amplification, and amplify the cryNGc gene (981bp size), bar Gene (352bp size). Among them, the primer pairs used in PCR amplification are shown in Table 1, the PCR reaction system is shown in Table 2, and the PCR reaction program is shown in Table 3.

[0052] Specific test res...

Embodiment 2

[0089] Example 2 Design and detect the primer pair of the right border side sequence of transgenic maize HiII-NGc-1, and carry out specific detection

[0090] Design primer AP2 according to the corn genomic DNA part in the right border flanking sequence of transgenic corn HiII-NGc-1, match with GSP2, carry out PCR detection with transgenic corn genomic DNA as template, PCR reaction system and reaction procedure are the same as embodiment 1, purpose The band size is 855bp. Among them, AP2: GACGAAGGTGATGTTTGCCGAAGGT (SEQ ID No. 10).

[0091]Select transgenic corn HiII-NGc-1, HiII-NGc-2, HiII-NGc-3, and non-transgenic corn HiII as templates. Genomic DNA of each material was extracted, and specific PCR detection was carried out. The PCR reaction system and reaction procedure were the same as in Example 1. Specific test results such as Figure 4 As shown, the genomic DNA of insect-resistant and herbicide-resistant corn HiII-NGc-1 can be amplified to obtain the target fragment, w...

Embodiment 3

[0092] Sensitivity detection of embodiment 3 specific primers

[0093] Genomic DNA of transgenic corn HiII-NGc-1 was extracted, and the DNA of HiII-NGc-1 was diluted according to 100%, 10%, 1%, 0.5%, 0.1%, 0.05%, and 0% (the DNA samples corresponding to each percentage The specific concentrations are 100ng / μl, 10ng / μl, 1ng / μl, 0.5ng / μl, 0.1ng / μl, 0.05ng / μl, 0ng / μl), which are used as templates for sensitivity detection. Genomic DNA samples with the above series of copy numbers were used as templates, and PCR amplification was performed using primers GSP2 and AP2. The reaction system and reaction procedure refer to Example 1. At the same time, a negative control with water instead of template DNA was set up in the experiment. The specific test results are as follows: Figure 5 shown.

[0094] The result shows: adopt primer GSP2 and AP3 to carry out PCR amplification, 0.5% genomic DNA sample (0.5ng / μl) can amplify the band that is 855bp in size (such as Figure 5 Show). The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a right border flanking sequence of an exogenous insertion segment of genetically modified corn HiII-NGc-1, an application of the sequence, a primer pair, a reagent kit and ause method of the reagent kit. The right border flanking sequence can specifically indicate the genetically modified corn HiII-NGc-1; the primer pair, the reagent kit and the use method of the reagentkit are based on the right border flanking sequence; whether a sample to be detected is the genetically modified corn HiII-NGc-1 can be detected quickly and accurately; and the right border flankingsequence has important significance on improvement of identification efficiency of the genetically modified corn HiII-NGc-1, management and detection of a genetically modified product and identification of a germplasm resource.

Description

technical field [0001] The present invention relates to the field of transgenic maize, in particular to the right border flanking sequence of the exogenous insertion fragment of transgenic maize HiII-NGc-1. Background technique [0002] In recent years, my country's corn planting area has increased steadily. With the increase of corn planting area, the occurrence of corn borer in northern spring corn area is heavy to large. In 2014, my country's corn planting area reached 553 million mu, and the occurrence area of ​​corn borer was 353 million mu, mainly concentrated in the Northeast, North China, and Huanghuaihai regions. Our country loses more than 30 million tons of corn due to pests every year. Due to the severity of insect pests, the high yield of maize varieties cannot be exerted normally, resulting in a decrease in yield, a gradual increase in the use of pesticides, and serious ecological problems such as soil residues are becoming increasingly prominent. [0003] B...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895
Inventor 刘相国刘洋尹悦佳郝东云
Owner JILIN ACAD OF AGRI SCI