Preparation method and application of humanized gene modification animal model

An animal model and humanized technology, applied in the field of establishment of humanized genetic animal models, can solve problems such as inapplicability, achieve the effects of saving time and cost, speeding up the research and development process, and reducing the risk of drug development

Active Publication Date: 2018-03-20
BIOCYTOGEN JIANGSU CO LTD +1
View PDF2 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the significant difference between human physiology and animal physiology, the experimental results obtained by using animal models sometimes cannot be applied to humans, while humanized animal models can well "replicate" certain human disease characteristics. It is used as an in vivo surrogate model for human disease research, and for in vivo drug efficacy testing experiments in preclinical drug development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of humanized gene modification animal model
  • Preparation method and application of humanized gene modification animal model
  • Preparation method and application of humanized gene modification animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0179] Example 1 Construction of pT7-sgRNA-PDL1 and pT7-sgRNA-PDL11

[0180] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0181] Taking mice as an example, guide RNA sequences that recognize 5' target sites (sgRNA1-sgRNA2, sgRNA4-sgRNA8) and 3' target sites (sgRNA9-sgRNA17) were designed and synthesized. According to the function and sequence characteristics of the Pd-l1 gene, the 5' and 3' target sites are both located on the third exon of the mouse Pd-l1 gene, and the target sites of each sgRNA on Pd-l1 The sequence of points is as follows:

[0182] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-gtatggcagcaacgtcacgatgg-3'

[0183] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-gcttgcgttagtggtgtactggg-3'

[0184] sgRNA-4 target site sequence (SEQ I...

Embodiment 2

[0211] Example 2 Construction of vector pClon-4G-PDL1

[0212] The main part of the No. 3 exon of the mouse Pd-l1 gene (Gene ID: 60533) (based on the transcript whose NCBI accession number is NM_021893.3 → NP_068693.1, its mRNA sequence is shown in SEQ ID NO: 26, The corresponding protein sequence is shown in SEQ ID NO: 27) is replaced with the corresponding fragment of human PD-L1 gene (Gene ID: 29126) (based on the transcript whose NCBI accession number is NM_014143.3→NP_054862.1, its mRNA sequence is shown in SEQ ID NO: 28, and the corresponding protein sequence is shown in SEQ ID NO: 29), wherein, the comparison diagram of mouse Pd-l1 and human PD-L1 is shown in image 3 , the schematic diagram of the transformed humanized mouse PD-L1 gene finally obtained is shown in Figure 4 , the humanized mouse PD-L1 gene DNA sequence (chimeric PD-L1 gene DNA) is shown in SEQ ID NO: 30:

[0213] gcgttact gtcacggttcccaaggacctatatgtggtagagtatggtagcaatatgacaattgaatgcaaattccc agtaga...

Embodiment 3

[0240] Example 3 Verification of vector pClon-4G-PD-L1

[0241] Randomly select 2 pClon-4G-PDL1 clones, and use 3 sets of enzymes to carry out digestion verification, among them, NcoI should appear 3615bp+2551bp+439bp, BglII+NdeI should appear 3775bp+1553bp+1282bp, HindIII should appear 4108bp+2354bp+143bp , the enzyme digestion results were in line with expectations, see Figure 6 , where the plasmids numbered 1 and 2 were verified to be correct by the sequencing company, and the plasmid numbered 2 was selected for subsequent experiments.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a humanized gene genetically modified non-human animal, particularly a genetically modified rodent, especially a genetically modified mouse, and in particular relates to a construction method of a humanized PD-L1 gene animal model and application of the model in the biomedicine field.

Description

technical field [0001] This application relates to the establishment method and application of a humanized gene animal model, in particular, to a construction method based on a humanized PD-L1 gene animal model and its application in biomedicine. Background technique [0002] Cancer is currently one of the diseases that cause the highest mortality in humans. According to the statistics of the World Health Organization, in 2012, the number of malignant tumor morbidity and death cases in the world reached 14 million and 8.2 million, and the number of newly diagnosed cancer cases in China was 3.07 million, and the death toll was 2.2 million. In recent years, the development of antibody drugs targeting immune checkpoints has been considered as a potential target to overcome various types of cancer. In traditional drug research and development, in vitro drug efficacy screening is adopted. This screening method cannot simulate the in vivo environment (such as tumor microenvironme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/90C12N15/113C12N15/12C07K14/705A01K67/027
CPCA01K67/0276A01K67/0278C07K14/70532C12N15/113C12N15/8509C12N15/907C12N2310/10C12N2800/107A01K2267/03A01K2217/072A01K2217/075A01K2227/105A01K2207/15A01K2217/15A01K2267/0331C07K14/70596C07H21/04
Inventor沈月雷白阳郭雅南黄蕤周小飞郭朝设
OwnerBIOCYTOGEN JIANGSU CO LTD