Preparation method and application of humanized gene modification animal model
An animal model and humanized technology, applied in the field of establishment of humanized genetic animal models, can solve problems such as inapplicability, achieve the effects of saving time and cost, speeding up the research and development process, and reducing the risk of drug development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0179] Example 1 Construction of pT7-sgRNA-PDL1 and pT7-sgRNA-PDL11
[0180] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.
[0181] Taking mice as an example, guide RNA sequences that recognize 5' target sites (sgRNA1-sgRNA2, sgRNA4-sgRNA8) and 3' target sites (sgRNA9-sgRNA17) were designed and synthesized. According to the function and sequence characteristics of the Pd-l1 gene, the 5' and 3' target sites are both located on the third exon of the mouse Pd-l1 gene, and the target sites of each sgRNA on Pd-l1 The sequence of points is as follows:
[0182] sgRNA-1 target site sequence (SEQ ID NO: 1): 5'-gtatggcagcaacgtcacgatgg-3'
[0183] sgRNA-2 target site sequence (SEQ ID NO: 2): 5'-gcttgcgttagtggtgtactggg-3'
[0184] sgRNA-4 target site sequence (SEQ I...
Embodiment 2
[0211] Example 2 Construction of vector pClon-4G-PDL1
[0212] The main part of the No. 3 exon of the mouse Pd-l1 gene (Gene ID: 60533) (based on the transcript whose NCBI accession number is NM_021893.3 → NP_068693.1, its mRNA sequence is shown in SEQ ID NO: 26, The corresponding protein sequence is shown in SEQ ID NO: 27) is replaced with the corresponding fragment of human PD-L1 gene (Gene ID: 29126) (based on the transcript whose NCBI accession number is NM_014143.3→NP_054862.1, its mRNA sequence is shown in SEQ ID NO: 28, and the corresponding protein sequence is shown in SEQ ID NO: 29), wherein, the comparison diagram of mouse Pd-l1 and human PD-L1 is shown in image 3 , the schematic diagram of the transformed humanized mouse PD-L1 gene finally obtained is shown in Figure 4 , the humanized mouse PD-L1 gene DNA sequence (chimeric PD-L1 gene DNA) is shown in SEQ ID NO: 30:
[0213] gcgttact gtcacggttcccaaggacctatatgtggtagagtatggtagcaatatgacaattgaatgcaaattccc agtaga...
Embodiment 3
[0240] Example 3 Verification of vector pClon-4G-PD-L1
[0241] Randomly select 2 pClon-4G-PDL1 clones, and use 3 sets of enzymes to carry out digestion verification, among them, NcoI should appear 3615bp+2551bp+439bp, BglII+NdeI should appear 3775bp+1553bp+1282bp, HindIII should appear 4108bp+2354bp+143bp , the enzyme digestion results were in line with expectations, see Figure 6 , where the plasmids numbered 1 and 2 were verified to be correct by the sequencing company, and the plasmid numbered 2 was selected for subsequent experiments.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


