PIK3CA gene targeted-knockout sgRNA and application thereof

A targeted and genetic technology, applied in DNA/RNA fragments, translation products of oncogenes, genetic engineering, etc., can solve the problems of RNA interference, low efficiency, and unsuitability for long-term inhibition research, and achieve simple construction methods and low cost , highly operable effect

Inactive Publication Date: 2018-03-23
KUNMING UNIV OF SCI & TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, RNA interference technology is still used in the study of breast cancer-related genes. Its main disadvantage is the interference at the RNA level, which is inefficient and not suitable for long-term inhibition research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PIK3CA gene targeted-knockout sgRNA and application thereof
  • PIK3CA gene targeted-knockout sgRNA and application thereof
  • PIK3CA gene targeted-knockout sgRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0029] Experimental Example 1: Construction of Knockdown PIK3CA Gene Expression Plasmid Using CRISPR-Cas9 Technology

[0030] 1. sgRNA oligonucleotide chain synthesis

[0031] Using the CRISPR online design tool (http: / / crispr.mit.edu / ), input the 1st exon sequence of PIK3CA, and select the sgRNA sequence with a high scoring rate from the given sequence, and then synthesize it by Sangon.

[0032] Table 1 sgRNA oligonucleotide sequences

[0033] ;

[0034] 2. Use the following primers to amplify sgRNA (sgRNA1 or sgRNA2) fragments

[0035] CRISPR-F: 5'-GTATTTCGATTTCTTGGCTTTATATATCT-3'

[0036] CRISPR-R: 5'-GTTGATAACGGACTAGCCTTATTTTAC-3'

[0037] Primer dilution, CRISPR-F, CRISPR-R primers with sterilized ddH 2 O was diluted to a final concentration of 0.1 μM, and the PCR reaction system was configured as follows:

[0038]

[0039] After mixing the above reagents, put them on the PCR machine. The reaction conditions are: ①94°C, 5min pre-denaturation; ②94°C, 30s denatur...

Embodiment 2

[0055] Example 2: Verification of knockout efficiency

[0056] Cultured with 1640 containing 10% fetal bovine serum in 5% CO 2 , cultured SK-BR-3 cells at a constant temperature of 37°C; 5 Inoculate each well into a six-well plate for culture, and when the cell confluence reaches 70%-80% after 24 hours, add 2.5 μg each of PENTY-U6-EF1a-Cas9-sg1 and PENTY-U6-EF1a-Cas9-sg2 with Lipofectamine®2000 reagent Transfect into different wells respectively, add only transfection reagent as control to one well, transfect for 48 hours, digest and collect cells in each well.

[0057] Cell lines were collected to extract protein, and Western blotting was used to detect the expression of PI3K protein in each group of cells; the results showed that breast cancer epithelial cells SK-BR-3-sg1 and SK-BR-3-sg2 experimental groups Compared with SK-BR-3-WT, the expression level of PI3K protein was significantly reduced ( Figure 4 ).

[0058] It shows that the cas9 system constructed by the prov...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PIK3CA gene targeted-knockout sgRNA and an application thereof. The PIK3CA gene targeted-knockout sgRNA has one of the following nucleotide sequences: a, sgRNA1: TCCGCGGCTCTAACCGCATCGGG; and b, sgRNA2: ACCCGATGCGGTTAGAGCCGCGG. The sgRNA has a high cleavage efficiency on the PIK3CA gene; and the PI3K protein expression level of a cell strain obtained through transferring aCRISPR-Cas9 system plasmid containing the sgRNA into a breast cancer SK-BR-3 cell line is significantly reduced. The sgRNA provided by the invention can realize the effective targeted knockout of thePIK3CA gene in order to facilitate the study of the action mechanism after low expression of PI3K in the cell line is facilitated, and makes an important contribution to the research of tumor cells targeting the PIK3CA gene.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an sgRNA targeting knockout of the PIK3CA gene and its application. Background technique [0002] The PIK3CA gene is located at 3q26.3 and is 34kb long, including 20 exons. At present, it is generally believed that PIK3CA is an oncogene, and its mutation has been reported in various solid tumors such as colon cancer, brain cancer, breast cancer, and lung cancer. PIK3CA encodes the p110 catalytic subunit of class I phosphatidylinositol-3-kinase, PI3Kp110α. The current mainstream academics believe that PIK3CA mutations mainly affect the occurrence and development of tumors through the PI3K / AKT pathway, and due to the heterogeneity of tumors, it is found that the downstream effects of PIK3CA mutations are not all through this pathway, so the downstream of PIK3CA mutations The molecular mechanism of pathway regulation and stimulation needs further in-depth exploration. [0003] Breast...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N5/10C12N15/90
CPCC12N5/0693C12N15/113C12N15/907C07K14/82C12N2310/10
Inventor戴文珠唐文如毕明瑜刘宁罗瑛盛苗苗
OwnerKUNMING UNIV OF SCI & TECH