Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for assessing radiation dose of potatoes by using polymerase chain reaction (PCR) technology

A technology for irradiation dose and potatoes, which is applied in the field of evaluating potato irradiation dose by PCR technology, can solve the problems of poor stability and accuracy, and achieve the effect of effective and reliable detection means

Active Publication Date: 2018-05-15
SICHUAN INST OF ATOMIC ENERGY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims to solve the problem of poor stability and accuracy of the results of the existing "comet DNA method", and provides a method for evaluating the irradiation dose of potatoes by PCR technology. The multiple relationship of irradiated DNA is the object of analysis. By analyzing the functional relationship between "irradiation dose-initial cycle number", a standard curve is constructed to finally realize the quantitative evaluation of irradiated DNA damage.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for assessing radiation dose of potatoes by using polymerase chain reaction (PCR) technology
  • Method for assessing radiation dose of potatoes by using polymerase chain reaction (PCR) technology
  • Method for assessing radiation dose of potatoes by using polymerase chain reaction (PCR) technology

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0048] Example 1: Irradiation Quantitative Identification of Potato Samples

[0049] Eight unirradiated potatoes from the same batch of moderate size were taken and irradiated according to the set gradient dose (0kGy, 0.5kGy, 1kGy, 2kGy, 4kGy, 6kGy, 8kGy, 10kGy). According to the results of the dose bottle, the actual radiation dose corresponding to the gradient radiation dose sample is shown in Table 1

[0050] Table 1 The actual dose of samples in the irradiation group

[0051]

[0052] Take 4 unirradiated potato samples and irradiate them according to the sample number 4, that is, 2.12kGy of irradiation as the potato samples T1-T4 to be tested.

[0053] Take 8 standard curve potato samples and 4 potato samples (T1-T4) to be tested, use the column separation DNA extraction kit to extract the total DNA and volatilize ethanol, and obtain a total of 12 DNA samples, using 96-well plates and real-time quantitative PCR The primers used for real-time quantitative PCR are:

[...

Embodiment 2

[0072] The difference between this embodiment and the embodiment is that the primer pair P1 sequence of this embodiment is:

[0073] 5'CAACGCGCAAAACCTTACCA 3'

[0074] 5'AACGATGAGTGTTCGCCCTT 3'

[0075] The primer pair P2 sequence is:

[0076] 5'AGCACTACCGGTGGAAGGTA 3'

[0077] 5'TTAGCCAAAGGTCGCTTGGA 3'.

[0078] The initial cycle number C of the sample obtained in this primer combination T The result is brought into the formula:

[0079] X=2^(△C TD(P1，P2) )=2^(C TD(P2) -C TD(P1) )

[0080] Then the X result is shown in Table 2:

[0081] Table 2 Exponential function value results of initial cycle number difference

[0082]

[0083]

[0084] According to the linear regression result of the exponential function value of the difference between the actual radiation dose and the initial cycle number, the standard curve of "irradiation dose-the exponential function value of the difference between the initial cycle number" is obtained as follows: figure 2 Shown:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for assessing radiation dose of potatoes by using a polymerase chain reaction (PCR) technology. The method comprises the steps of firstly, treating the unirradiated potatoes by means of gradient dose irradiation, extracting a total DNA template of samples, and using two pairs of identification primers (P1,P2) to perform quantitative PCR Livak analysis so as to establish a standard curve of 'an exponential function of irradiation dose-initial cycle number difference value'. The same PCR method is used for detecting the samples to be tested and acquiring the CT values of the initial cycle numbers of the samples; the corresponding irradiation dose is deduced based on the established standard curve, so that the quantitative radiation identification of the potatoes can be realized. Compared with the existing 'comet DNA method', the method can improve the accuracy of the results of food irradiation identification, can reduce the implementation cost of the detection method, and has important application values in the quality and safety control of irradiated food production and irradiation processing enterprises as well as food radiation identification business of the food safety supervision departments and the import and export inspection and quarantine department.

Description

technical field [0001] The invention relates to the technical field of food radiation detection, in particular to a method for evaluating the radiation dose of potatoes by PCR technology. Background technique [0002] The identification of irradiated food is a general term for various methods to test whether the food is irradiated and whether the radiation dose meets the safety standards. An important link in the quality and safety of irradiated food (fruits and vegetables, meat products, aquatic products, etc.), irradiation processing, inspection and quarantine. Through quantitative irradiation identification, food with insufficient or over-irradiated dose can be screened to increase the safety of irradiated food and improve consumer acceptance. The radiation identification method of the current national standard "Comet DNA method" (GB 23748-2016) is derived from the European Standards Committee standard EN 13.784 (CEN, 2001). This method is used to detect DNA damage cause...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851
CPCC12Q1/6851C12Q2531/113
Inventor 刘绵学黄敏伏毅王艳瞿攀
Owner SICHUAN INST OF ATOMIC ENERGY