Unlock instant, AI-driven research and patent intelligence for your innovation.
DNA frameworks for circular RNA overexpression and their applications
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
An overexpression and circular technology, applied in the field of DNA framework, can solve the problems of low overexpression efficiency and achieve the effect of easy construction, simple design, and various choices
Active Publication Date: 2021-06-25
浙江自贸区锐赛生物医药科技有限公司
View PDF3 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
This method is not suitable for the overexpression of artificially designed circular RNA
In 2014, Liang used the upstream and downstream sequence research of hsa_circ_0001727 to optimize and construct a circRNA expression framework, but the expression framework has limitations, and it is only effective for the overexpression of some endogenous circRNAs, and the overexpression efficiency is low
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0027] Example 1: construction of has_circ_0001727 overexpression vector
[0028] 1. Sequence design of hsa_circ_0001727 overexpression framework:
[0029] The linear DNA sequence encoding the hsa_circ_0001727 circular RNA was obtained from the circBase database. The sequence is shown in SEQ ID NO.3.
[0030] According to the above-mentioned general circRNA overexpression DNA framework sequence design principle, the DNA sequence of hsa_circ_0001727 queried is replaced by [N] in the sequence of formula I n , to obtain the dedicated overexpression framework DNA sequence of hsa_circ_0001727, as shown in SEQ ID NO.4.
[0031] And further, in other embodiments, such as figure 1 As shown, n can also adopt 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000 or even more multiples, which can be the same N or a different N.
[0032] 2. Submit the dedicated overexpression framework DNA sequence of hsa_circ_0001727 to Nanjing GenScript Company for sequence synt...
Embodiment 2
[0073] Example 2: qPCR detection of hsa_circ_0001727 overexpression effect in 293T cells after hsa_circ_0001727 overexpression plasmidtransfection
[0074] 1, qPCR primer design and synthesis
[0075] divergent primer-F: CAGGTCAAGTTCATGGACCTG
[0076] divergent primer-R: ATTCAGACTTACCTGAAGTA
[0077] The primer sequences were synthesized by Shanghai Huada Gene Company.
[0078] 2. 24 hours before transfection, digest 293T cells in the logarithmic growth phase with trypsin, pass to a six-well plate, 37°C, 5% CO 2 Cultured in an incubator. After 24 hours, when the cell density reaches 70%-80%, it can be used for transfection.
[0079] 3. Replace the cell culture medium with serum-free medium before transfection.
[0080] 4. Add 25ug of the prepared hsa_circ_0001727 overexpression plasmid DNA solution to a sterilized centrifuge tube, mix well with the corresponding volume of Opti-MEM, and adjust the total volume to 1.5ml.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to a DNA framework for circular RNA overexpression and its application. The artificially synthesized DNA framework sequence is inserted into eukaryotic expression vectors, lentiviral vectors, adenoviral vectors, and adeno-associated viral vectors to form circRNA dedicated expression vector. The DNA framework sequence and its corresponding expression vector involved in the present invention can be widely used in the expression of various circRNAs, and provide a favorable tool for studying the function and mechanism of circRNAs and further developing gene therapy drugs based on circRNAs.
Description
[technical field] [0001] The present invention relates to a DNA framework for circular RNA overexpression and its application. [Background technique] [0002] Circular RNA (circular RNA, circRNA) is a new type of RNA that is different from traditional linear RNA. It does not have the 5' end cap and 3' end poly(A) tail in traditional linear RNA, but exists in a closed circular structure. . Studies have shown that circular RNAs are mainly produced through atypical variable shear processing, and widely exist in various biological cells. Spatiotemporal specificity and other characteristics. Studies on circRNA and diseases have shown that circRNA is related to the occurrence and progression of tumors, neurodevelopment, atherosclerosis, myotonic dystrophy and other diseases. In addition, studies have found that stable circRNAs can be detected in human saliva and blood. These characteristics make circular RNAs have broad prospects for the development and application of new disea...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More