Enzymatic method for preparing L-xylose

An enzymatic and xylose technology, applied in the field of enzymatic preparation of L-xylose, can solve the problems affecting the extraction process and product quality, unsuitable for L-xylose raw materials, low post-processing efficiency, etc., to achieve low pollution and easy operation Simple and easy to control, the effect of a single raw material

Active Publication Date: 2018-06-15
SHANGHAI LINKCHEM TECH CO LTD
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, xylose is prepared by acid extraction, and sulfuric acid is mostly used for hydrolysis of xylose produced by acid method. However, xylose produced by acid method has the following disadvantages: ① a large amount of sulfuric acid is used in the production process, and sulfuric acid makes the cellulose and hemicellulose in the raw materials and other sugars are hydrolyzed, producing a variety of by-products, which affect the post-extraction process and product quality
②Extraction of xylose by acid method, due to the addition of a large amount of strong acid and strong alkali liquid in the production process, a large amount of production waste liquid is produced in the production process, which has caused huge pollution to the environment
③ Due to the many impurities in the sugar solution of acid hydrolysis, the post-treatment efficiency is low, the chemical procedures are many, the requirements for equipment are high, and the cost of environmental protection is increased
[0004] At present, the production of L-xylose is mainly by the method of chemical synthesis, there are the above-mentioned unfavorable factors
L-xylose can also be converted from L-xylulose, but L-xylulose is a rare sugar with a high price, so it is not suitable as a raw material for the production of L-xylose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enzymatic method for preparing L-xylose
  • Enzymatic method for preparing L-xylose
  • Enzymatic method for preparing L-xylose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] (1) Preparation of pyruvate decarboxylase

[0023] Primers were designed according to the pyruvate decarboxylase gene sequence of Saccharomyces cerevisiae in Genebank, as follows:

[0024] Upstream primer: CATGCCATGGATTCAATTACTTTGGGTAAATATTTGTTCG

[0025] Downstream primer: CCGCTCGAGTTGCTTAGCGTTGGTAGCAGCAGTC

[0026] After the PCR product of pyruvate decarboxylase was inserted into the plasmid pET-22b, the recombinant expression plasmid pET-22b-pdc was constructed.

[0027] Take 0.01g of the recombinant expression plasmid pET-22b-pdc to transform Escherichia coli BL21(DE3) competent cells, culture in 600μL LB medium for 1h, take 100μL of the bacterial liquid and spread it on a solid LB plate containing ampicillin, at 37℃ Cultivate for 10 hours to obtain genetically engineered bacteria capable of highly expressing pyruvate decarboxylase.

[0028] The constructed engineered bacteria were inoculated in TB medium containing ampicillin, and cultured at 37°C until the bact...

Embodiment 2

[0032] Substantially the same as Example 1, the difference is that the buffer is an MES buffer, pH7.5, 5mM magnesium chloride, 1mM thiamine pyrophosphate and 300mM 2-keto-L-gulonic acid, and the conversion rate is similar to that of Example 1 Ratio, increased by 16.9%, that is, 28.0g / L L-xylose was generated.

Embodiment 3

[0034] Basically the same as Example 1, the difference is that the reaction temperature is 45 ° C, 5mM magnesium chloride, 1mM thiamine pyrophosphate, 300mM 2-keto-L-gulonic acid, and the conversion rate is compared with Example 1, which has increased by 24.5 %, that is, 31.4g / L L-xylose was generated.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an enzymatic method for preparing L-xylose and belongs to the field of bioengineering. In the method, 2-keto-L-gulonic acid is dissolved in a buffer containing magnesium ions and thiamine pyrophosphate, and pyruvate decarboxylase is added to the buffer for an enzyme-catalyzed reaction at a suitable temperature. After the end of the reaction, the production of the L-xylose is proved by a high performance liquid chromatograph. A new method for producing the L-xylose is found. The method is low in raw material cost, has no pollution to the environment, and has important economic and social benefits.

Description

technical field [0001] The invention relates to an enzymatic preparation method of L-xylose, which belongs to the field of bioengineering. Background technique [0002] Xylose is a five-carbon sugar, D-xylose mainly exists in plants and animals. Xylose is a non-calorie sweetener, widely used in food, medicine, chemical industry and other fields. Eating xylose can improve the microbial environment of the human body, improve the body's immunity, and is an ideal sweetener for diabetics. [0003] At present, xylose is prepared by acid extraction, and sulfuric acid is mostly used for hydrolysis of xylose produced by acid method. However, xylose produced by acid method has the following disadvantages: ① a large amount of sulfuric acid is used in the production process, and sulfuric acid makes the cellulose and hemicellulose in the raw materials And other carbohydrates are hydrolyzed to produce a variety of by-products, which affect the post-extraction process and product quality...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/02
CPCC12P19/02
Inventor陆茜
OwnerSHANGHAI LINKCHEM TECH CO LTD