Unlock instant, AI-driven research and patent intelligence for your innovation.

PCC1-Brick vector construction and application in field of gene synthesis

A carrier and gene technology, applied in the field of genetic engineering, can solve problems such as inability to improve cytotoxic tolerance, loss, and inaccessibility

Inactive Publication Date: 2018-06-29
NANJING GENSCRIPT BIOTECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Usually these sequences are toxic and will affect the normal growth of cells, resulting in the failure of conventional synthetic methods to obtain these gene sequences
The currently used pUC57-Brick vector does not have good tolerance to toxic genes, and cannot improve the tolerance of cells to toxicity, resulting in mutations or deletions in the cloned sequence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCC1-Brick vector construction and application in field of gene synthesis
  • PCC1-Brick vector construction and application in field of gene synthesis
  • PCC1-Brick vector construction and application in field of gene synthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] A segment of the yeast key element CEN / ARS sequence and LEU2 sequence was loaded into pCC1 by PCR cloning, thereby constructing the shuttle plasmid pCC1-Brick, which can grow pCC1 in both yeast cells and E. coli cells.

[0073] Material: pCC1 plasmid (the source is a plasmid from Epicentre Company, the article number is CCPCR1CC) containing LEU2 and CEN / ARS gene synthesis fragments

[0074] Yeast strain BY4741

[0075] ypd medium, full amino acid lacking leucine medium

[0076] Method: homologous recombination method for connection

[0077] Specific experimental conditions and steps:

[0078] 1. Gene synthesis of LEU2 and CEN / ARS fragments.

[0079] See SEQ ID NO.11 for the LEU2 and CEN / ARS sequences; see SEQ ID No.12 for the pCC1 plasmid sequence;

[0080] 2. Design primers

[0081] Analyze LEU2 and CEN / ARS sequences, design 1 pair of primers at the head and tail of the sequence to amplify each

[0082] About 500bp. The numbers and sequences are as follows:

[...

Embodiment 2

[0111] Material: Dengue virus type 2 polyprotein mRNA, complete cds whole gene synthesis fragment (A, B, C, D)

[0112] pCC1-Brick plasmid

[0113] Yeast strain BY4741

[0114] ypd medium, full amino acid lacking leucine medium

[0115] Method: homologous recombination method for connection

[0116] Specific experimental conditions and steps:

[0117] 1. Gene synthesis of A, B, C, D fragments.

[0118] The sequence of Fragment A is shown in SEQ ID No.1:

[0119] Fragment B sequence is shown in SEQ ID No.2:

[0120] Fragment C sequence is shown in SEQ ID No.3:

[0121] The sequence of Fragment D is shown in SEQ ID No.4:

[0122] See SEQ ID No.5 for the pCC1-Brick plasmid sequence:

[0123] 2. Design primers

[0124] Analyze the gene sequence of Fragment A, and design a pair of primers at the head and tail of the sequence to amplify about 500 bp at the head and tail respectively. The numbers and sequences are as follows:

[0125]Dengue cds-L1F2: TTAATACGACTCACTATAAG ...

Embodiment 3

[0165] Material: Human respiratory syncytial virus strain A2, complete genome synthetic fragments (A, B, C, D, E)

[0166] pCC1-Brick plasmid

[0167] Yeast strain BY4741

[0168] ypd medium, full amino acid lacking leucine medium

[0169] Method: homologous recombination method for connection

[0170] Specific experimental conditions and steps:

[0171] 1. Gene synthesis of A, B, C, D, E fragments.

[0172] The sequence of Fragment A is shown in SEQ ID No.6:

[0173] Fragment B sequence is shown in SEQ ID No.7:

[0174] Fragment C sequence is shown in SEQ ID No.8:

[0175] The sequence of Fragment D is shown in SEQ ID No.9:

[0176] The sequence of Fragment E is shown in SEQ ID No.10:

[0177] See SEQ ID No.5 for the pCC1-Brick plasmid sequence:

[0178] 2. Design primers

[0179] Analyze the gene sequence of Fragment A, and design a pair of primers at the head and tail of the sequence to amplify about 500 bp at the head and tail respectively. The numbers and seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pCC1-Brick vector construction and application in the field of gene synthesis. The vector is obtained by loading a CEN / ARS sequence and an LEU2 sequence of a segment of key component of yeast into a pCC1 plasmid by using a PCR cloning method and constructing. The toxicity problem of dengue virus can be solved by using a pCC1-Brick vector, and further the whole-gene combination of the dengue virus can be completed in cell bodies, so that the problem that a dengue virus genome is unstable or cannot be obtained is solved. Meanwhile, the vector is also proved to be effective for the whole-gene synthesis of other viruses, so that the synthesized vector greatly benefits the synthesis of large genes such as toxic genes, unstable genes and viral sequences, and the competition status of an applicant in the field of gene synthesis is promoted.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to the construction of a vector that can be replicated in both yeast and Escherichia coli. After further modification of the vector, the vector can be used to synthesize many unstable sequences, such as viral sequences, which is more convenient for scientific research Researchers understand how the virus works, which has further promoted the development of vaccines. Background technique [0002] Applicant launches GenBrick TM The long-fragment large gene synthesis service uses the pUC57-Brick vector to assemble a long-fragment gene of 8-15kb in one step, which greatly saves time and cost. And the synthesized sequence is 100% accurate, without mutations and errors. However, with the transfer of biological research hotspots, more and more scientific research customers use this platform to synthesize genome sequences of many viruses. Usually, these sequences are toxic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85
CPCC12N15/85C12N2800/107
Inventor 傅邦文夏秋徐士军
Owner NANJING GENSCRIPT BIOTECH CO LTD