PCC1-Brick vector construction and application in field of gene synthesis
A carrier and gene technology, applied in the field of genetic engineering, can solve problems such as inability to improve cytotoxic tolerance, loss, and inaccessibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] A segment of the yeast key element CEN / ARS sequence and LEU2 sequence was loaded into pCC1 by PCR cloning, thereby constructing the shuttle plasmid pCC1-Brick, which can grow pCC1 in both yeast cells and E. coli cells.
[0073] Material: pCC1 plasmid (the source is a plasmid from Epicentre Company, the article number is CCPCR1CC) containing LEU2 and CEN / ARS gene synthesis fragments
[0074] Yeast strain BY4741
[0075] ypd medium, full amino acid lacking leucine medium
[0076] Method: homologous recombination method for connection
[0077] Specific experimental conditions and steps:
[0078] 1. Gene synthesis of LEU2 and CEN / ARS fragments.
[0079] See SEQ ID NO.11 for the LEU2 and CEN / ARS sequences; see SEQ ID No.12 for the pCC1 plasmid sequence;
[0080] 2. Design primers
[0081] Analyze LEU2 and CEN / ARS sequences, design 1 pair of primers at the head and tail of the sequence to amplify each
[0082] About 500bp. The numbers and sequences are as follows:
[...
Embodiment 2
[0111] Material: Dengue virus type 2 polyprotein mRNA, complete cds whole gene synthesis fragment (A, B, C, D)
[0112] pCC1-Brick plasmid
[0113] Yeast strain BY4741
[0114] ypd medium, full amino acid lacking leucine medium
[0115] Method: homologous recombination method for connection
[0116] Specific experimental conditions and steps:
[0117] 1. Gene synthesis of A, B, C, D fragments.
[0118] The sequence of Fragment A is shown in SEQ ID No.1:
[0119] Fragment B sequence is shown in SEQ ID No.2:
[0120] Fragment C sequence is shown in SEQ ID No.3:
[0121] The sequence of Fragment D is shown in SEQ ID No.4:
[0122] See SEQ ID No.5 for the pCC1-Brick plasmid sequence:
[0123] 2. Design primers
[0124] Analyze the gene sequence of Fragment A, and design a pair of primers at the head and tail of the sequence to amplify about 500 bp at the head and tail respectively. The numbers and sequences are as follows:
[0125]Dengue cds-L1F2: TTAATACGACTCACTATAAG ...
Embodiment 3
[0165] Material: Human respiratory syncytial virus strain A2, complete genome synthetic fragments (A, B, C, D, E)
[0166] pCC1-Brick plasmid
[0167] Yeast strain BY4741
[0168] ypd medium, full amino acid lacking leucine medium
[0169] Method: homologous recombination method for connection
[0170] Specific experimental conditions and steps:
[0171] 1. Gene synthesis of A, B, C, D, E fragments.
[0172] The sequence of Fragment A is shown in SEQ ID No.6:
[0173] Fragment B sequence is shown in SEQ ID No.7:
[0174] Fragment C sequence is shown in SEQ ID No.8:
[0175] The sequence of Fragment D is shown in SEQ ID No.9:
[0176] The sequence of Fragment E is shown in SEQ ID No.10:
[0177] See SEQ ID No.5 for the pCC1-Brick plasmid sequence:
[0178] 2. Design primers
[0179] Analyze the gene sequence of Fragment A, and design a pair of primers at the head and tail of the sequence to amplify about 500 bp at the head and tail respectively. The numbers and seque...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


