Method for knocking out Endoglin gene by using CRISPR/Cas9 technology

A gene and technology technology, applied in the field of knocking out the Endoglin gene by using CRISPR/Cas9 technology, can solve the problem of weak tumor proliferation ability

Inactive Publication Date: 2018-08-10
GUANGXI MEDICAL UNIVERSITY
View PDF2 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the early stage of tumor angiogenesis, tumor cells only rely on the simple cell proliferation ability to proliferate steadily, and the simple diffusion method is used to absorb nutrients and discharge metabolites, forming cell clusters with no blood vessel structure, so the tumor proliferation ability is weak , the tumor can only grow to about a few cubic millimeters. When this simple substance metabolism pathway cannot satisfy the tumor growth, the tumor enters a relatively static growth period.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out Endoglin gene by using CRISPR/Cas9 technology
  • Method for knocking out Endoglin gene by using CRISPR/Cas9 technology
  • Method for knocking out Endoglin gene by using CRISPR/Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1.1 Materials and methods

[0034] 1.1.1 Experimental materials

[0035] Liver cancer tissues and paracancerous tissues were collected from the Department of Hepatobiliary Surgery, Cancer Hospital Affiliated to Guangxi Medical University, and the expression of Endoglin was detected in tumor tissues and paracancerous tissues of patients with hepatocellular carcinoma by immunohistochemistry; human highly metastatic liver cancer cell line HCCLM3 was purchased from Shanghai Fuxiang Biological Co., Ltd.; female BalB / C nude mice used in the experiment, born (4-6) weeks old, weighing (18-20) grams, were purchased from the Medical Experimental Animal Center of Guangxi Medical University and raised in SPF grade Mouse housing. All animal experiment protocols comply with the animal protection and use management regulations of Guangxi Medical University, and have been certified by the Ethics Committee of Guangxi Medical University; the CRISPR / Cas9 system plasmid vector Px458 was p...

Embodiment 2

[0045] 2 results

[0046] 2.1 High expression of CD105 in liver cancer tissues of clinical patients

[0047] The specimens collected from patients with hepatocellular carcinoma were detected and analyzed by immunohistochemical methods. For tumor tissue specimens and paracancerous tissue specimens, see figure 1 A / B, visible CD105 + The number of cells in tumor tissue was significantly more than that in paracancerous tissue, and in figure 1 The statistical analysis of C showed that in tumor tissue CD105 + The number of cells is significantly more than that of the paracancerous tissue, ** P <0.01.

[0048] 2.2 The results of the sequencing peak map show that the sgRNA has been successfully inserted into the Px458 vector

[0049] figure 2 -A / B. The designed sgRNA sequence "GGACCGCGGCACGCTCCCTC" has been successfully inserted into the Px458 vector, and the target sequence has been marked in black font in the sequencing results of the Px458-gRNA 1 / 2 monoclonal plasmid.

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for knocking out an Endoglin gene by using a CRISPR / Cas9 technology, belonging to the technical fields of genetic engineering, immunology and oncology. The method comprises a CRISPR / Cas9 gRNA sequence for the Endoglin gene knockout; the sequence is shown in SEQ ID No. 1; the CRISPR / Cas9 gRNA sequence for the Endoglin gene knockout is designed in a first exon. The invention further studies the indispensable role of Endoglin in occurrence, development and metastasis processes of malignant tumor cells, and explores the effect of using a CRISPR / Cas9 gene editing technology to treat a mouse liver cancer model, so that a new ideal is provided for clinical tumor treatment.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering, immunology and oncology, and particularly relates to a method for knocking out Endoglin gene by using CRISPR / Cas9 technology and its application. Background technique [0002] Tumor is an abnormal lesion formed by a certain cell in a local tissue losing its normal regulation of its growth at the gene level under the action of various carcinogenic factors, resulting in its clonal abnormal proliferation. In the late 20th century In the past 30 years, the incidence of cancer has been on the rise. According to the report of the World Health Organization (WHO), the number of new cancer cases in the world in 1990 was about 8.07 million, an increase of 37.4% from 5.17 million in 1975. The number of cancer deaths is about 6.2 million, and according to current trends, as the world population reaches 8 billion by 2020, there will be 20 million new cancer cases, of which the death toll will rea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/90C12N5/10A61K35/13A61P35/00
CPCA61K35/13A61P35/00C07K14/70596C12N5/0693C12N9/22C12N15/113C12N15/85C12N15/907C12N2310/10C12N2510/00C12N2800/107C12N2810/10
Inventor赵永祥钟莉娉阳诺
OwnerGUANGXI MEDICAL UNIVERSITY