A method for preparing bio-based nylon-54 precursor by co-fermentation with genetically engineered bacteria
A technology of bio-based nylon and genetically engineered bacteria is applied in the field of preparing bio-based nylon-54 precursors, which can solve problems such as poor results, reduce carbon loss and greenhouse gas emissions, improve process efficiency and process yield, The effect of reducing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0032] The construction of embodiment 1 recombinant plasmid
[0033] Using the Escherichia coli genome as a template, PCR amplification was performed with primers at both ends of the lysine decarboxylase gene cadA gene; the obtained cadA fragment was cloned into the NdeI and KpnI sites of the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-CadA.
[0034] Among them, the conditions of PCR are: reaction system 50 μL, the specific components are: genome template, 1 μL; upstream primer, 2 μL; downstream primer, 2 μL; enzyme, 1 μL; dNTPs, 4 μL; 5x buffer, 10 μL; ddH 2 O, 30 μL. The amplification program was: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55-57°C for 30 s, extension at 72°C for 75 s, and 25-30 cycles; extension at 72°C for 10 min.
[0035] Wherein, when the primers at both ends of the lysine decarboxylase gene cadA are used for PCR amplification, the upstream primer is GGAATTCCATATGAACGTTATTGCAATATTG, and the downstream p...
Embodiment 2
[0036] The construction of embodiment 2 recombinant plasmids
[0037] Using the plasmid pETDuet-CadA obtained in Example 1 as a template, PCR amplification was performed using the upstream primer CadA-4A-F and the downstream primer CadA-4A-R to obtain the fragment CadA-4A; wherein, the conditions for PCR were: reaction system 50 μL, the specific components are: genome template, 1 μL; upstream primer, 2 μL; downstream primer, 2 μL; enzyme, 1 μL; dNTPs, 4 μL; 5x buffer, 10 μL; ddH 2 O, 30 μL. The amplification program is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 55-57°C for 30 seconds, extension at 72°C for 75 seconds, and 25-30 cycles; extension at 72°C for 10 minutes;
[0038] Using the plasmid pCDFDuet-1 as a template, the upstream primer Fuse-pCDF-F and the downstream primer Fuse-pCDF-R were used for PCR amplification to obtain the fragment CDF-4A; the PCR conditions were as follows: the reaction system was 50 μL, and the spe...
Embodiment 3
[0044] The preparation of embodiment 3 host cell competence
[0045] Using LB medium, cultivate E.coli AFP111 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared into a chemically competent state.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap