A method for preparing bio-based nylon-54 precursor by co-fermentation with genetically engineered bacteria

A technology of bio-based nylon and genetically engineered bacteria is applied in the field of preparing bio-based nylon-54 precursors, which can solve problems such as poor results, reduce carbon loss and greenhouse gas emissions, improve process efficiency and process yield, The effect of reducing production costs

Active Publication Date: 2020-11-10
NANJING TECH UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is to provide a method for preparing bio-based nylon-54 precursor—pentamethylenediamine succinate by co-fermentation with genetically engineered bacteria, so as to solve the problems of poor effect in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The construction of embodiment 1 recombinant plasmid

[0033] Using the Escherichia coli genome as a template, PCR amplification was performed with primers at both ends of the lysine decarboxylase gene cadA gene; the obtained cadA fragment was cloned into the NdeI and KpnI sites of the vector pETDuet-1 to obtain the recombinant plasmid pETDuet-CadA.

[0034] Among them, the conditions of PCR are: reaction system 50 μL, the specific components are: genome template, 1 μL; upstream primer, 2 μL; downstream primer, 2 μL; enzyme, 1 μL; dNTPs, 4 μL; 5x buffer, 10 μL; ddH 2 O, 30 μL. The amplification program was: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55-57°C for 30 s, extension at 72°C for 75 s, and 25-30 cycles; extension at 72°C for 10 min.

[0035] Wherein, when the primers at both ends of the lysine decarboxylase gene cadA are used for PCR amplification, the upstream primer is GGAATTCCATATGAACGTTATTGCAATATTG, and the downstream p...

Embodiment 2

[0036] The construction of embodiment 2 recombinant plasmids

[0037] Using the plasmid pETDuet-CadA obtained in Example 1 as a template, PCR amplification was performed using the upstream primer CadA-4A-F and the downstream primer CadA-4A-R to obtain the fragment CadA-4A; wherein, the conditions for PCR were: reaction system 50 μL, the specific components are: genome template, 1 μL; upstream primer, 2 μL; downstream primer, 2 μL; enzyme, 1 μL; dNTPs, 4 μL; 5x buffer, 10 μL; ddH 2 O, 30 μL. The amplification program is: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 55-57°C for 30 seconds, extension at 72°C for 75 seconds, and 25-30 cycles; extension at 72°C for 10 minutes;

[0038] Using the plasmid pCDFDuet-1 as a template, the upstream primer Fuse-pCDF-F and the downstream primer Fuse-pCDF-R were used for PCR amplification to obtain the fragment CDF-4A; the PCR conditions were as follows: the reaction system was 50 μL, and the spe...

Embodiment 3

[0044] The preparation of embodiment 3 host cell competence

[0045] Using LB medium, cultivate E.coli AFP111 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared into a chemically competent state.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing bio-based nylon-54 precursor-pentylenediamine butanediate by using the co-fermentation of genetically engineered bacteria. Lysine decarboxylase is over-expressed in succinic acid generation strain, the lysine is added to perform the decarboxylation in the fermentation process of succinic acid, two decarboxylation products, i.e., pentamethylene diamineand CO2 are respectively used for synthesizing a regulating agent for the system pH and succinic acid, the co-fermentation production of succinic acid and the fixation of CO2 are realized, and pentylenediamine butanediate in a fermentation solution can be used as a precursor to be further used for polymerizing the bio-based nylon-54. Compared with the existing preparation method of the nylon-54,the method is simple in process, low in cost, safe and controllable in process, environmentally friendly, high in application value, and good in economical performance.

Description

technical field [0001] The invention belongs to the field of microbial fermentation, and in particular relates to a method for preparing bio-based nylon-54 precursor by co-fermentation with genetically engineered bacteria. Background technique [0002] At present, the global nylon (PA) output is about 6 million tons, and it is growing at a rate of 5.4% per year, of which 38% is used as fiber, 46% is injection molding, 14% is extrusion molding, and the remaining deep-processed products account for about 2%. , of which China's consumption accounts for 30% of global nylon production. The global nylon market is expected to reach $43.7 billion by 2020. However, the monomers currently used to produce nylon are still obtained through chemical processing and are derivatives of fossil resources. With the depletion of fossil resources and the strengthening of people's awareness of environmental protection, more attention has been paid to environmentally friendly materials based on b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N15/57C12P13/02C12R1/19
CPCC12N9/48C12N15/70C12P13/02C12Y401/01018
Inventor陈可泉王璟许晟程琪田威龙魏国光欧阳平凯
OwnerNANJING TECH UNIV