Human Cx43 gene inference sequence, shRNA-Cx43 virus and low expression Cx43 protein cell line
A gene interference and cell line technology, applied in the field of human Cx43 gene interference sequence, shRNA-Cx43 virus and cell lines with low expression of Cx43 protein, can solve the problem of inability to connect protein compensation and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] 1) Design the interference site CTGGCCTTGAATATCATTGAACTC according to the human Cx43 (NCBI Reference Sequence: NM_000165.4) gene. Primer synthesis, annealing the single-stranded primer into a double-stranded oligo sequence, connecting into the pLKD-CMV-G&PR-U6-shRNA (Heyuan Biotechnology (Shanghai) Co., Ltd.) interference vector linearized by AgeI and EcoRI double digestion, replacing Drop the original ccdB toxic gene. The transformants were screened by colony PCR, and the screened positive clones were verified by sequencing. Correct clones were verified by sequencing, and high-purity plasmid extraction was carried out.
[0015] 2) Virus packaging. The constructed plasmids were packaged by Heyuan Biotechnology (Shanghai) Co., Ltd.: the extracted high-purity target plasmids and packaging plasmids pLP1-gag / pol, pLP2-Rev and pLP / VSVG (Heyuan Biotechnology (Shanghai) Co., Ltd.) were transferred into 293T cells; the transfection efficiency was observed under a microscope;...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com