Screening method for aptamers and aptamer specifically bond with pseudomonas aeruginosa

A Pseudomonas aeruginosa and nucleic acid aptamer technology, applied in biochemical equipment and methods, microbial measurement/inspection, instruments, etc., can solve the problem that the on-site detection technology of Pseudomonas aeruginosa has not attracted too much research attention , Pseudomonas aeruginosa cannot be detected and other problems, to achieve good detection ability, good specificity and sensitivity, and accurate detection effect

Active Publication Date: 2018-11-06
OCEAN UNIV OF CHINA +1
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

EC and Codex stress that Pseudomonas aeruginosa cannot be detected in drinking water
However, the development of aptasensor-based on-site detection of Pseudomonas aeruginosa has not attracted much research attention, leading to great challenges in this field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening method for aptamers and aptamer specifically bond with pseudomonas aeruginosa
  • Screening method for aptamers and aptamer specifically bond with pseudomonas aeruginosa
  • Screening method for aptamers and aptamer specifically bond with pseudomonas aeruginosa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Aptamer Screening

[0047] 1. Design random library sequences:

[0048] 5'-TGGACCTTGCGATTGCGATTGACAGC(40nt)GCAGACATGAGTCT-CAGGAC-3' has a random region of 40 nucleotides in the middle and a fixed region of 20 nucleotides at both ends. The total sequence length is 80 nucleotides.

[0049] The primer sequences used for screening are:

[0050] Upstream primer: TGGACCTTGCGATTGACAGC

[0051] Downstream primer 1: GTCCTGAGACTCATGTCTGC

[0052] Downstream primer 2: 5'-biotinGTCCTGAGACTCATGTCTGC

[0053] The above nucleic acid sequences were completed by Shanghai Sangon Biotechnology Co., Ltd.

[0054] 2. Using WB-SELEX technology to screen Pseudomonas aeruginosa aptamers

[0055] The screening process of Pseudomonas aeruginosa nucleic acid aptamer is as follows: figure 1 -A shown.

[0056] 1) The strains used for screening and their cultivation and collection:

[0057] Aptamer screening was performed using Pseudomonas aeruginosa ATCC 27853. E. coli ATCC25922,...

Embodiment 2

[0089] Embodiment 2 detects Pseudomonas aeruginosa

[0090] 1. Synthesize the aptamer-CD / GO biosensor first

[0091] CDs were synthesized using a hydrothermal method, and then 100 μL of CD solution (8 μg / mL) in 5 mM PBS buffer was mixed with 30 μl of N-(3-dimethylaminopropyl)-ethylcarbodiimide hydrochloride (EDC) (1 mg / μl) and N-hydroxysuccinimide (NHS) (1 mg / μl) to activate the carboxyl group, and sonicate for 30 min at 25°C. Afterwards, 10 μL of the sonicated mixture was added to 90 μL of candidate aptamers with modified amino groups at a concentration of 3.3 μM in 5 mM PBS buffer and incubated at 25 °C for 2 h to prepare aptamer-CD. 50 μL of GO (1 mg / mL) was added to 25 μL of the aforementioned aptamer-CDs solution (100 nM) to quench the fluorescence, and then the mixture was incubated at 37 °C for 1 hour to prepare the aptamer-CD / GO biosensor.

[0092] 2. Detection of Pseudomonas aeruginosa

[0093] 100 μL of Pseudomonas aeruginosa (1×10 7 CFU / ml) was added to the reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
volumeaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to a screening method for aptamers and an aptamer specifically bond with pseudomonas aeruginosa. The aptamer provided by the invention has good specificity and sensitivity, a biosensor prepared by using the aptamer can realize accurate detection for pseudomonas aeruginosa, the detection range is 10<1> CFU / ml to 10<7> CFU / ml, the limit of detection is as low as 9 CFU / ul, and the aptamer has good detection capacity in the detection of the pollutants such as pseudomonas aeruginosa in a beverage.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleic acid aptamer screening method and a nucleic acid aptamer specifically binding to Pseudomonas aeruginosa. Background technique [0002] Nucleic acid aptamer (Aptamer) is a kind of aptamer that can bind to target molecules with high specificity and high affinity through screening from a large-capacity nucleic acid library through the systematic evolution of ligands by exponential enrichment (Systematic Evolution of Ligands by Exponential Enrichment). chain or sequence. However, Sanger sequencing used in the routine SELEX procedure leaves most of the sequences undetected due to its low-throughput nature, so the screened aptamers are not truly representative. In contrast, modern high-throughput sequencing technology (High-Throu-ghput Sequencing, HTS) can give a large amount of data in units of gigabytes, thereby ensuring sufficient sequence coverage to accurately identify in a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/115C12Q1/6825G01N33/569
CPCC12N15/115C12N2310/16C12Q1/6825G01N33/56905C12Q2563/107
Inventor刘晨光池哲王洪英于钰丁松李生慧
OwnerOCEAN UNIV OF CHINA