Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene sequence construct for treatment of central nervous system diseases

A technology of the central nervous system and gene sequence, which is applied in nervous system diseases, gene therapy, genetic engineering, etc., can solve problems such as expression imbalance, achieve the effect of improving balance and improving treatment effect

Pending Publication Date: 2018-11-20
KANGLIN BIOTECH HANGZHOU CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method has several problems, such as the expression of three genes by IRES often leads to imbalanced expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene sequence construct for treatment of central nervous system diseases
  • Gene sequence construct for treatment of central nervous system diseases
  • Gene sequence construct for treatment of central nervous system diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0050] One, such as figure 2 As shown, the construction of various constructs:

[0051] KL0039 vector, artificially synthesized CMV enhancer-synapsin promoter-AADC-P2A-GCH1-P2A-TH and AADC-SV40 promoter-TH-PGK promoter-GCH1 sequences (wherein TH is a truncated form of TH); wherein, CMV enhancer- The synapsin promoter-AADC-P2A-GCH1-P2A-TH is connected to the pUC57 vector (pUC57-synapsin-AGT); the KL0039 vector here is a lentiviral transfer vector, which is selected from existing lentiviral vectors or modified as needed A partially engineered lentiviral vector.

[0052] 1. PD1 vector construction

[0053] Using the KL0039 vector as a template, Age-F+Sal-R was used to amplify the sequence between WPRE and cPPT, and the PCR product was recovered and purified by electrophoresis. The primer sequences used were Age-F: CTGAGTGCCATTGGATGA caatcaacctctggattaca; Sal-R: gattactattaataactactcacgcatgctcttctcca. At the same time, pUC57-synapsin-AGT plasmid was digested with AgeI and Sal...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene sequence construct for the treatment of central nervous system diseases. Tyrosine hydroxylase (TH), GTP-cyclase hydrolase I (GCH1), aromatic amino acid dopa decarboxylase(AADC) and the like are simultaneously expressed through construction of an auto-processing expression vector; proteins are connected by auto-processing units (APU); and viral vectors are utilized tointroduce the proteins into target cells to finally produce high-efficiently expressed tyrosine hydroxylase (TH), GTP-cyclized hydrolase I (GCH1), aromatic amino acid dopa decarboxylase (AADC) and the like, which have independent functions and are used for prevention or treatment of Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases.

Description

technical field [0001] The present invention relates to the field of gene therapy, in particular to a gene sequence construct used for the treatment of central nervous system diseases, which can be used to prevent Parkinson's disease, Alzheimer's disease and other neurodegenerative diseases or treatment. Background technique [0002] Parkinson's disease (PD) is a neurodegenerative disorder characterized by the loss of dopaminergic neurons in the substantia nigra, resulting in decreased dopamine levels in the midbrain. Parkinson's disease affects about 1% of people over the age of 55 worldwide, and the patient population will continue to expand as society ages. A common treatment for Parkinson's disease is the oral administration of levodopa, a precursor of dopamine, which can relieve symptoms to some extent. However, with the development of the disease, levodopa treatment is not satisfactory. [0003] Gene therapy has unique advantages for the treatment of Parkinson's dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867A61K48/00A61P25/16A61P25/28
CPCA61K48/005A61P25/16A61P25/28C12N15/86C12N2740/15043C12N2800/107C12N9/0071C12Y305/04016C12N9/88A61K38/51A61K38/44A61K38/50C12Y114/16002C12N9/78C12Y401/01028C07K2319/50C12N2740/16043C12N15/62C12N15/52C07K2319/00C12N2770/32122C12N2750/10022A61K48/0058
Inventor 吴昊泉
Owner KANGLIN BIOTECH HANGZHOU CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com