Tumor marker STAMP-EP1 based on methylated modification

A methylation and tumor technology, applied in the direction of recombinant DNA technology, microbial measurement/testing, biochemical equipment and methods, etc., can solve problems such as misdiagnosis, difficult to use standards, inability to deal with tumor source, metastasis, etc.

Active Publication Date: 2018-11-23
SHANGHAI EPIPROBE BIOTECH CO LTD
View PDF5 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology is still in its infancy, and there are many shortcomings: First, the sensitivity and specificity are not high enough, the tumor itself has great heterogeneity, including cell groups of various subtypes, and clinical samples, especially blood samples, tumor The proportion of DNA is very small, and the existing tumor markers are difficult to meet the sensitivity required by the clinic, which is likely to cause misdiagnosis in the clinic; secondly, a marker only has a good effect on one or a few kinds of tumors, while the blood The source of DNA is very complex, so the existing tumor markers can not deal with complex tumor origin, metastasis and other issues
Due to the existence of these complex situations, it is difficult to have a uniform standard of use for many DNA methylation tumor markers in clinical application, which seriously affects the sensitivity and accuracy of the markers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor marker STAMP-EP1 based on methylated modification
  • Tumor marker STAMP-EP1 based on methylated modification
  • Tumor marker STAMP-EP1 based on methylated modification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1, the nucleic acid sequence detected for STAMP-EP1

[0080] The sequence of the STAMP-EP1 tumor marker is provided, as shown in the following SEQ ID NO: 1 (chr14: 60975733bp ~ 60978180bp (hg19 / Human)), where the bases indicated by the underline are methylated CpG sites, and the numbers below the underline indicate the The number of the site.

[0081]

[0082]

[0083] The above sequence of SEQ ID NO:1 is treated with bisulfite and the sequence is as follows: SEQ ID NO:2 (wherein Y represents C or U):

[0084]

[0085]

[0086]上述SEQ ID NO:1所示核苷酸序列的反向互补序列如下SEQ ID NO:3:CGCTGGTTCCCGTGGTCGCGGCCAAAGGGCGCCAGTGAAGCCAGGCCGGCCGCGGGGTGGGGCGGGAAACGGCAACCCGAGCCCGCGGGTCCCTGGTCACCTGGCTTCTGTGGCGCTGGATTTGCAGGTCTCTCATCTTCTTCCCCTCTTTCATTTTGTTTTTCTCGTTTTTACACTGGAATCTGCTTCTGAGCATCCTGGATGGGCAACTCAGATGTCGCACTCGCTGTCGCTGGACGTGATGGAGATGGCTGAAGTGGCCGCCTTGCTGGATAGACTGGCGGCCGGGCTGGTGGCGACGCCCAGCACCTCTGGCGTGCCGTCGCCCTCCGCCCGTAGTGCCCGCCCGGAACCCTGTGACAGGACCTGCTGCTGGAGTCTACGGGGAAG...

Embodiment 2

[0089] Example 2, STAMP-EP1: Lung cancer cell line model detection-BSP (Bisulfite Sequencing PCR) detection method

[0090] 1. Extract the genomic DNA of lung cancer cell line A549 and normal lung fibroblast cell line MRC5;

[0091] 2. Treat the extracted A549 and MRC5 cell line genomic DNA with bisulfite, respectively, as templates for subsequent PCR amplification;

[0092] 3. Design amplification primers according to the sequence of SEQ ID NO: 1. For different sequence regions, design 4 pairs of primers for amplification. The primer sequences and detection methylation sites are shown in Table 1.

[0093] Table 1

[0094]

[0095] 4. After PCR amplification, 2% agarose gel electrophoresis was used to detect the specificity of the PCR fragment, the gel was cut to recover the target fragment, ligated and inserted into the T vector, transformed into competent E. 10 clones were picked for Sanger sequencing;

[0096] 5. Analyze the sequencing results such as figure 1 As sho...

Embodiment 3

[0098] Example 3, STAMP-EP1: lung cancer-clinical case sample verification-pyrosequencing method

[0099] 1. Obtain clinical samples: 20 pairs of paracancerous-lung cancer samples were obtained from the clinic, the paracancerous samples were used as the lung cancer control group, and the lung cancer samples were used as the lung cancer experimental group;

[0100] 2. DNA extraction: extract the DNA of the experimental group and the control group respectively; this experiment uses the phenol-chloroform extraction method, but is not limited to this method;

[0101] 3. Bisulfite treatment: treat the extracted DNA samples with bisulfite, and operate in strict accordance with the steps; in this experiment, EZ DNA Methylation-Gold Kit from ZYMO Research Company, Cat. No. D5006 was used, but not limited to this kit;

[0102] 4. PCR amplification: the samples treated with bisulfite were used as PCR products, PCR amplification primers and pyrosequencing primers were designed according ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a methylated tumor marker STAMP-EP1 and application thereof and belongs to the field of molecular biology. The invention provides application of the methylated tumor marker STAMP-EP1 in preparation of tumor diagnosis reagents. The tumor marker STAMP-EP1 provided by the invention is hypermethylated in all tumor types, is hypomethylated in corresponding normal tissues, and hasvery high sensibility and specificity. A primer for detecting the STAMP-EP1 can be used for preparing a tumor diagnosis kit.

Description

technical field [0001] The invention belongs to the field of disease diagnostic markers, more specifically, the invention relates to a tumor marker STAMP (Specific Tumor Aligned Methylation of Pan-cancer) based on methylation modification. Background technique [0002] The occurrence and development of tumors is a complex, multi-level, and multi-factorial dynamic process, including the intricate interaction of various factors such as the external environment, genetic variation, and epigenetic changes. External environmental factors include physical, chemical, biological and other carcinogenic factors and unhealthy living habits, etc. Genetic variation includes gene mutation, copy number change, chromosomal misalignment, etc. Epigenetic changes mainly include DNA methylation, histone modification, non-coding RNA and other factors. During the occurrence and development of tumors, environmental factors, genetic factors, and epigenetic factors complement each other and work tog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/154C12Q1/6806
Inventor李振艳
OwnerSHANGHAI EPIPROBE BIOTECH CO LTD