Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of gmcop1a and/or gmcop1b in regulating plant height

A kind of plant and aspect technology, applied in the application field of regulating plant height, can solve the problems of soybean plant type, yield and quality impact, narrow photoperiod adaptability, etc.

Active Publication Date: 2020-08-07
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a typical short-day plant, the growth period of most soybean varieties has narrow adaptability to the photoperiod in different latitudes; in addition, the light environment in different ecological regions and cultivation modes also has a significant impact on soybean plant type, yield and quality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gmcop1a and/or gmcop1b in regulating plant height
  • Application of gmcop1a and/or gmcop1b in regulating plant height
  • Application of gmcop1a and/or gmcop1b in regulating plant height

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of soybean GmCOP1s gene mutant plant expression vector.

[0032] The present invention provides primers for constructing expression vectors,

[0033] It includes primers for amplifying RNA sequences containing guide:

[0034] COP1a-F1-4:

[0035] AATGTGCCACCACATGGATTGGGTTCAGGTTTGACGACGGGTTTTAGAGCTAGAAATAGCAA;

[0036] COP1a-F1-8:

[0037] AATGTGCCACCACATGGATTGTGCAGATGCTTGACGGTTCGTTTTGAGCTAGAAATAGCAA;

[0038] COP1b-F1-8:

[0039] AATGTGCCACCACATGGATTGTACGGATGCTTGACGACTCGTTTTGAGCTAGAAATAGCAA;

[0040] COP1b-F1-9:

[0041] AATGTGCCACCACATGGATTGCTTCATTAGTGCTGTATGCGTTTTGAGCTAGAAATAGCAA;

[0042] gRNA-Xbal-R:

[0043] GCTCGGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGT;

[0044] Primers used to amplify the U6 fragment:

[0045] U6-Xbal-F:

[0046] GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC;

[0047] U6-R: CAATCCATGTGGTGGCACAT.

[0048] 1. Prime Star amplifies the target fragment

[0049] 1) Reaction system:

[0050]

[0051] The backbone of the JR...

Embodiment 2

[0095] The acquisition of embodiment 2 transgenic soybean plants

[0096] After the constructed plasmid containing GmCOP1 cDNA was transformed into Agrobacterium, soybean transformation was carried out.

[0097] 1. Preparation and transformation of Agrobacterium competent

[0098] 1) Preparation of Competent Agrobacterium

[0099] Single colonies of Agrobacterium K599 and EHA105 were picked and placed in 5 mL of LB liquid medium containing corresponding antibiotics. The resistance of K599 was 100 μg / mL streptomycin; the resistance of EHA105 was 100 μg / mL rifampicin (Rif). Cultivate overnight at 28°C; take 500 μL of the overnight culture and inoculate it into 50 mL LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD600 is about 0.5; place on ice for 30 min; centrifuge at 5,000 rpm for 10 min at 4°C, and pre-cool with 15 mL 10mM CaCl 2 Resuspend the Agrobacterium cells, centrifuge at 5,000 rpm for 10 min at 4°C; use 2 mL of pre-cooled 10 ...

Embodiment 3

[0122] Identification of embodiment 3 transgenic positive strains

[0123] In order to determine the transgenic positive plants, take a piece of fresh and tender leaves, extract DNA, and carry out PCR detection. Among them, for the CRISPR knockout mutant, we detected its Basta resistance gene, Cas9 protein and U6 promoter. The location of the gRNA was amplified by PCR and sequenced.

[0124] According to PCR detection, Gmcop1a-4, Gmcop1a-8, Gmcop1b-8 and Gmcop1a-8 / 1b-9 plants all contained Basta, Cas9 and U6, but Gmcop1b-9 was absent. For specific sequencing results, see figure 1 , 2 and 3.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology and specifically discloses application of GmCOP1a and / or GmCOP1b in an aspect of regulating a plant height. The GmCOP1a and the GmCOP1b come from soybeans; amino acid sequences of the GmCOP1a and the GmCOP1b are correspondingly as shown in SEQ ID NO.2 and SEQ ID NO.4. According to the application of the GmCOP1a and / or the GmCOP1b in the aspect of regulating the plant height, coding genes of the GmCOP1a and / or the GmCOP1b are coded by using a CRISPR-Cas9 system; and it is found that the plant height has no obvious change after the GmCOP1amutates, the plant height is reduced after the GmCOP1b mutates, the plant height is reduced after the GmCOP1a and the GmCOP1b both mutate, and the reduction of the plant height of a plant in which theGmCOP1a and the GmCOP1b both mutate is more obvious than the reduction of the plant height of a plant in which only the GmCOP1b mutates. Therefore, the application of the GmCOP1a and / or the GmCOP1b in the aspect of regulating the plant height, disclosed by the invention, provides a new option for plant height regulation means.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of GmCOP1a and / or GmCOP1b in regulating plant height. Background technique [0002] COP1 is an E3 ubiquitin ligase. Whether in animals or plants, COP1 is relatively conserved during evolution, and plays a very important role in various growth and development processes. Previous studies have shown that in Arabidopsis, COP1 is the main factor responsible for the rapid degradation of photolabile photoreceptors under light. At the same time, COP1 is also a core inhibitor of photomorphogenesis, which can promote the selective degradation of target proteins. The Arabidopsis COP1 gene is at the core of the light signal transduction pathway. The gene responds to and integrates various light signals to regulate plant photomorphogenesis, flowering induction, and biological rhythms (Lau and Deng, 2012). [0003] Soybean is one of the important food, oil and feed cr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/54
CPCC12N9/93C12N15/8218C12N15/8261
Inventor 赵涛许欣颖李宏宇刘斌刘军
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD