Application of gmcop1a and/or gmcop1b in regulating plant height
A kind of plant and aspect technology, applied in the application field of regulating plant height, can solve the problems of soybean plant type, yield and quality impact, narrow photoperiod adaptability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Construction of soybean GmCOP1s gene mutant plant expression vector.
[0032] The present invention provides primers for constructing expression vectors,
[0033] It includes primers for amplifying RNA sequences containing guide:
[0034] COP1a-F1-4:
[0035] AATGTGCCACCACATGGATTGGGTTCAGGTTTGACGACGGGTTTTAGAGCTAGAAATAGCAA;
[0036] COP1a-F1-8:
[0037] AATGTGCCACCACATGGATTGTGCAGATGCTTGACGGTTCGTTTTGAGCTAGAAATAGCAA;
[0038] COP1b-F1-8:
[0039] AATGTGCCACCACATGGATTGTACGGATGCTTGACGACTCGTTTTGAGCTAGAAATAGCAA;
[0040] COP1b-F1-9:
[0041] AATGTGCCACCACATGGATTGCTTCATTAGTGCTGTATGCGTTTTGAGCTAGAAATAGCAA;
[0042] gRNA-Xbal-R:
[0043] GCTCGGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGT;
[0044] Primers used to amplify the U6 fragment:
[0045] U6-Xbal-F:
[0046] GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC;
[0047] U6-R: CAATCCATGTGGTGGCACAT.
[0048] 1. Prime Star amplifies the target fragment
[0049] 1) Reaction system:
[0050]
[0051] The backbone of the JR...
Embodiment 2
[0095] The acquisition of embodiment 2 transgenic soybean plants
[0096] After the constructed plasmid containing GmCOP1 cDNA was transformed into Agrobacterium, soybean transformation was carried out.
[0097] 1. Preparation and transformation of Agrobacterium competent
[0098] 1) Preparation of Competent Agrobacterium
[0099] Single colonies of Agrobacterium K599 and EHA105 were picked and placed in 5 mL of LB liquid medium containing corresponding antibiotics. The resistance of K599 was 100 μg / mL streptomycin; the resistance of EHA105 was 100 μg / mL rifampicin (Rif). Cultivate overnight at 28°C; take 500 μL of the overnight culture and inoculate it into 50 mL LB liquid medium containing the corresponding antibiotics, cultivate at 28°C until the OD600 is about 0.5; place on ice for 30 min; centrifuge at 5,000 rpm for 10 min at 4°C, and pre-cool with 15 mL 10mM CaCl 2 Resuspend the Agrobacterium cells, centrifuge at 5,000 rpm for 10 min at 4°C; use 2 mL of pre-cooled 10 ...
Embodiment 3
[0122] Identification of embodiment 3 transgenic positive strains
[0123] In order to determine the transgenic positive plants, take a piece of fresh and tender leaves, extract DNA, and carry out PCR detection. Among them, for the CRISPR knockout mutant, we detected its Basta resistance gene, Cas9 protein and U6 promoter. The location of the gRNA was amplified by PCR and sequenced.
[0124] According to PCR detection, Gmcop1a-4, Gmcop1a-8, Gmcop1b-8 and Gmcop1a-8 / 1b-9 plants all contained Basta, Cas9 and U6, but Gmcop1b-9 was absent. For specific sequencing results, see figure 1 , 2 and 3.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


