Escherichia coli expression vector pBMcopA and application thereof

A technology of expression vector and Escherichia coli, which is applied in the field of genetic engineering and can solve problems such as the absence of T7 polymerase

Inactive Publication Date: 2019-01-25
CHENGDU UNIVERSITY OF TECHNOLOGY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the existing E. coli expression plasmids are based on T7 polymerase for high-efficiency expression of foreign genes, but T7 polymerase often does not exist in other host bacteria, and often only the plasmids that come with the bacteria can be selected for transformation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli expression vector pBMcopA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Construction of embodiment 1 expression vector pBMcopA

[0028] Find the promoter sequence of the copper ion ATP transporter of Serratia marcescens on NCBI, design the primer sequence, and verify the specificity of the primers and multiple homologous strains on NCBI, and design Serratia marcescens respectively Copper ion ATP transporter promoter front primer and back primer. The designed primers were synthesized by a gene sequencing company, and the method of primer synthesis was the solid-phase phosphoramidite triester method.

[0029] The designed primers are:

[0030] Fragment copF: cttgcatgcccgccgataaaacgccttg;

[0031] Fragment copR: ggcatatgcaacggctcagtttttggg.

[0032] According to the designed primers, PCR technology was used to amplify the promoter fragment in Serratia marcescens, that is, the front end and back end of the non-coding region of CopA.

[0033] PCR condition setting: denaturation at 95°C for 5 minutes; denaturation at 95°C for 30s, annealing a...

Embodiment 2

[0039] Example 2 Construction of expression vector pBMcopA-pigC

[0040] 1) According to Serratia marcescens copper ion ATP transporter promoter sequence and Serratia prodigiosin condensing enzyme (pigC) sequence design three primers, primer sequence:

[0041] copCR: atgtggactccttgcttaggggc;

[0042] pigCF: cctaagcaaggagtccacatatgaatcctaccctggtggt;

[0043] pigCR:cccaagctttgctgattagccatcggcac.

[0044] The primer copCR and the primer pigCF contain 20bp complementary sequence.

[0045] 2) Using PCR technology to re-amplify the Serratia marcescens copper ion ATP transporter promoter with primers copF and primer copCR, and the gel recovery product of Example 1 as a template, so that the fragment has the sequence: ATGTGGACTCCTTGCTTAGG.

[0046] PCR reaction conditions: 95°C, 5 minutes; TOUCH-DOWN cycle 10 times: 94°C, 15 seconds; 55°C, 30 seconds; 72°C, 60 seconds; 72°C, 5 minutes; 4°C storage; 20μL system: 2μL 10 *Taq buffer, 2μL MgCl 2 , 1 μL 10mmdNTP, 10 μL Q1, 10 μL Q2, 0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an Escherichia coli expression vector pBMcopA and an application thereof, the expression vector is composed of pBM16A-T, copA promoter and restriction endonuclease sites BamH Iand Nde I are added to the TA junction region of pBM16A-T. Also disclosed is an expression vector pBMcopA-pigC, which is constructed from pBMcopA, also includes the gene of interest, the gene of interest is prodigiosin condensase (pigC) gene. The invention also provides a construction method of the two expression vectors. The constructed expression vector can express the target gene in Escherichia coli containing copper ion ATP transporter and can be used as an optional plasmid for gene modification.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an Escherichia coli expression vector pBMcopA and an application thereof. Background technique [0002] With the recognition of prokaryotes, more and more types of microorganisms have been discovered. To engineer these microorganisms, the construction of shuttle expression vectors has received considerable attention. Escherichia coli is a relatively common prokaryotic bacterium that is easy to cultivate and accumulate biomass, and it is easy to genetically modify and recombine it. Therefore, commonly used shuttle plasmids are constructed based on specific strains and E. coli. Most of the existing E. coli expression plasmids are based on T7 polymerase for high-efficiency expression of foreign genes, but T7 polymerase often does not exist in other host bacteria, and often only the plasmids that come with the bacteria can be selected for transformation. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/70C12N15/66C12N9/00
CPCC12N9/93C12N15/66C12N15/70
Inventor 王以明张叶飞马宸张瑾童晋
Owner CHENGDU UNIVERSITY OF TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap