Escherichia coli expression vector pBMcopA and application thereof
A technology of expression vector and Escherichia coli, which is applied in the field of genetic engineering and can solve problems such as the absence of T7 polymerase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Construction of embodiment 1 expression vector pBMcopA
[0028] Find the promoter sequence of the copper ion ATP transporter of Serratia marcescens on NCBI, design the primer sequence, and verify the specificity of the primers and multiple homologous strains on NCBI, and design Serratia marcescens respectively Copper ion ATP transporter promoter front primer and back primer. The designed primers were synthesized by a gene sequencing company, and the method of primer synthesis was the solid-phase phosphoramidite triester method.
[0029] The designed primers are:
[0030] Fragment copF: cttgcatgcccgccgataaaacgccttg;
[0031] Fragment copR: ggcatatgcaacggctcagtttttggg.
[0032] According to the designed primers, PCR technology was used to amplify the promoter fragment in Serratia marcescens, that is, the front end and back end of the non-coding region of CopA.
[0033] PCR condition setting: denaturation at 95°C for 5 minutes; denaturation at 95°C for 30s, annealing a...
Embodiment 2
[0039] Example 2 Construction of expression vector pBMcopA-pigC
[0040] 1) According to Serratia marcescens copper ion ATP transporter promoter sequence and Serratia prodigiosin condensing enzyme (pigC) sequence design three primers, primer sequence:
[0041] copCR: atgtggactccttgcttaggggc;
[0042] pigCF: cctaagcaaggagtccacatatgaatcctaccctggtggt;
[0043] pigCR:cccaagctttgctgattagccatcggcac.
[0044] The primer copCR and the primer pigCF contain 20bp complementary sequence.
[0045] 2) Using PCR technology to re-amplify the Serratia marcescens copper ion ATP transporter promoter with primers copF and primer copCR, and the gel recovery product of Example 1 as a template, so that the fragment has the sequence: ATGTGGACTCCTTGCTTAGG.
[0046] PCR reaction conditions: 95°C, 5 minutes; TOUCH-DOWN cycle 10 times: 94°C, 15 seconds; 55°C, 30 seconds; 72°C, 60 seconds; 72°C, 5 minutes; 4°C storage; 20μL system: 2μL 10 *Taq buffer, 2μL MgCl 2 , 1 μL 10mmdNTP, 10 μL Q1, 10 μL Q2, 0...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com